Nitrilase mutant with improved catalytic activity and reaction specificity and application

A technology of nitrilase and mutants, applied in the field of bioengineering, can solve the problems of production process and production cost increase, achieve the effects of reducing industrial production costs, improving nitrilase activity and reaction specificity, and good application prospects

Active Publication Date: 2021-02-12
ZHEJIANG UNIV OF TECH
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Although the by-product can be further hydrolyzed by coupling amidase, it will lead to an increase in the production process and production cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nitrilase mutant with improved catalytic activity and reaction specificity and application
  • Nitrilase mutant with improved catalytic activity and reaction specificity and application
  • Nitrilase mutant with improved catalytic activity and reaction specificity and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: Contain the construction of the recombinant escherichia coli of nitrilase mutant BaNITmut / V82L

[0045] In order to perform site-directed mutation at the 82nd position Val in the parental amino acid sequence, corresponding primers were designed, and the primer sequences are shown in Table 1. Using the recombinant plasmid pET28b-BaNITmut containing the target gene fragment as a template, its amino acid sequence is shown in SEQ ID NO.2, and its nucleotide sequence is shown in SEQ ID NO.1. According to the method of overlap extension PCR, the whole plasmid was carried out on the template Amplify.

[0046] Table 1: Primer Design Table

[0047] Primer name Primer sequence (5'to 3') V82L-Forward TATCGTTTCGGCATC GGTCTGGGTGTGCACAAC V82L-Reverse GTTGTGCACACCCCAGACCGATGCCGAAACGATA C237S-Forward TTCGTTCTGTCTGCTTCCCAGTTCTGCCGTCGT C237S-Reverse ACGACGGCAGAACTGGGAAGCAGACAGAACGAA

[0048] The PCR amplification system is (50 μ...

Embodiment 2

[0052] Example 2: Construction of recombinant E. coli containing nitrilase mutant BaNITmut / V82L / C237S

[0053] In order to construct the nitrilase double mutant BaNITmut / V82L / C237S, corresponding primers were designed, and the primer sequences are shown in Table 1.

[0054] Using the recombinant plasmid pET28b-BaNITmut / V82L constructed in Example 1 as a template, the construction method refers to Example 1 to obtain recombinant engineering bacteria E.coli BL21(DE3) / pET28b-BaNITmut / V82L / C237S, the amino acid sequence of which is as SEQ ID NO. 6, and the nucleotide sequence is shown in SEQ ID NO.5.

Embodiment 3

[0055] Example 3: Induced expression of recombinant Escherichia coli containing nitrilase mutants

[0056] Inoculate the recombinant Escherichia coli of the parental nitrilase BaNITmut and the mutants BaNITmut / V82L and BaNITmut / V82L / C237S obtained in Examples 1 and 2 into LB liquid medium containing 50 μg / mL kanamycin, and cultivate overnight at 37°C , then inoculated into LB medium containing 50 μg / mL kanamycin with 2% inoculum size (v / v), cultivated to thalline concentration OD at 37° C., 150 rpm 600 = about 0.6, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, then centrifuge at 4°C and 12000rpm for 10min to collect the bacterial cells, wash the wet bacterial cells with 0.85% normal saline, and store them at -20°C for later use (i.e. static cells for hydrolysis reactions).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a nitrilase mutant and application thereof in hydrolysis of racemic isobutyl butyronitrile to synthesize a pregabalin chiral intermediate (S)-3-cyano-5-methyl hexanoic acid andbelongs to the technical field of bioengineering. The nitrilase mutant BaNITmut / V82L with the amino acid sequence as shown in SEQ ID NO.4 or the double mutant BaNITmut / V82L / C237S with the amino acidsequence as shown in SEQ ID NO.6 can catalyze high-concentration IBSN hydrolysis, and amide byproducts are remarkably reduced. The nitrilase activity and the reaction specificity are improved througha directed evolution technology, industrial production cost is greatly reduced, and the method has a good application prospect in industrial production of the pregabalin chiral intermediate (S)-3-cyano-5-methyl caproic acid.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a mutant of a plant-derived nitrilase, a coding gene, and a chiral intermediate (S)-3-cyano in the hydrolysis of racemic isobutylsuccinonitrile to synthesize pregabalin - Application of 5-methylhexanoic acid. Background technique [0002] Pregabalin, whose chemical name is (S)-3-aminomethyl-5-methylhexanoic acid, has the structural formula (I), and is the 3-position of the inhibitory neurotransmitter γ-aminobutyric acid (GABA). Isobutyl substituents (Angew. Chem. Int. Ed., 2008, 47:3500-3504). Pregabalin is the drug of choice for treating conditions such as nerve pain, anxiety, and epilepsy. Therefore, it is of great significance to develop a green, efficient, and highly optically pure pregabalin synthesis process. [0003] [0004] (S)-3-cyano-5-methylhexanoic acid (CMHA) is the key chiral intermediate of pregabalin, and this compound can be synthesized into S-form pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/78C12N15/55C12N15/70C12N1/21C12P41/00C12P13/00C12R1/19
CPCC12N9/78C12N15/70C12P41/006C12P13/002C12Y305/05001
Inventor郑仁朝卢夏锋吴哲明林超平郑裕国
OwnerZHEJIANG UNIV OF TECH