A rapid chromogenic parthenogenetic induction line and its application in the identification of maize haploid

A technology of parthenogenesis and haploid, which is applied in the rapid chromogenic parthenogenetic haploid induction line and its application in the identification of maize haploid, so as to improve efficiency, improve accuracy and reduce the consumption of culture materials Effect

Active Publication Date: 2021-10-26
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The color marking of the parthenogenetic haploid induction line is required to jointly drive multiple anthocyanin synthesis-related genes, and can be specifically expressed in the grain. If it is used to identify haploid immature embryos, it also has certain requirements for the anthocyanin expression period At present, there is no report on the use of anthocyanin markers to directly identify haploid immature embryos without additional culture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rapid chromogenic parthenogenetic induction line and its application in the identification of maize haploid
  • A rapid chromogenic parthenogenetic induction line and its application in the identification of maize haploid
  • A rapid chromogenic parthenogenetic induction line and its application in the identification of maize haploid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Creation of maize parthenogenic haploid induction line

[0027] 1. Preparation of corn materials

[0028] In July 2018, haploid parthenogenetic inducible lines CAU5 and CAU6 were planted at the experimental base of China Agricultural University in Shangzhuang, Beijing, and Lx59 was planted at the transgenic base of the Chinese Academy of Agricultural Sciences, carrying the vector pBD-C1R2. See the vector structure figure 1, F1 was assembled that year, and then a parthenogenetic haploid induction line with haploid induction ability and target expression vector was created. The parthenogenetic haploid induction line was used to hybridize with the female parent material Zhengdan 958, and the haploid identification accuracy and haploid induction rate were counted. After the expression of the anthocyanin color marker, the haploid identification can be carried out. The parthenogenic haploid induction line created by the invention can identify haploids from 12 days...

Embodiment 2

[0034] Example 2 Identification method of maize haploid immature embryos

[0035] 1. The production of haploids

[0036] 1. Hybridization

[0037] (1) Hybrid parent

[0038] Zhengdan 958 was used as the female parent, and the conventional parthenogenetic haploid induction line CAU5 was used as the male parent, and the hybrid offspring 1 was obtained;

[0039] Zhengdan 958 was used as the female parent, and the conventional parthenogenetic haploid induction line CAU6 was used as the male parent, and the hybrid offspring 2 was obtained;

[0040] Zhengdan 958 was used as the female parent, and the rapid chromogenic parthenogenetic haploid induction line was used as the male parent, and crossed to obtain a hybrid offspring 3;

[0041] (2) Specific method of hybridization

[0042] Before the filaments of the female parent are spit out, they are detasseled and the ears are bagged; after the filaments are spit out, the filaments are cut at the same time, and pollination is perfor...

Embodiment 3

[0067] Example 3 For containing ZmC1 suppressor gene ( ZmC1-I ) Haploid induction experiment of selected line materials

[0068] Color suppressor gene testing

[0069] multiple inbred lines ZmC1-I Genetic testing found that K22 and Yu8701 contain ZmC1-I gene, and use the R1- nj The diploid embryos obtained from the labeled conventional parthenogenetic haploid induction line were poorly colored, and the specific detection primers were as follows:

[0070] C1-IF(5'-3'): TACACTCGCCCTCATAGCAG

[0071] C1-IR(5'-3'): CAAACCTGCACCCACACAC

[0072] 1. Identification of haploid immature embryos

[0073] In May 2020, planted at the Experimental Station of China Agricultural University in Beijing ZmC1-I Germplasm K22 and Yu 8701 were planted together with conventional parthenogenetic haploid induction line CAU6 and rapid chromogenic parthenogenetic haploid induction line. And take the embryo 15 days after pollination, the result ( Figure 7 for K22, Figure 8 Yu 8701) found...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rapid chromogenic parthenogenetic induction line and its application in distinguishing maize haploid. Construction of PZmBD1 or PZmBD1, 2RS5GPA promoters to drive and control anthocyanin synthesis regulatory genes ZmC1 , ZmR2 An expression vector for creating anthocyanin-enriched embryo / grain transgenic maize, using two major genes that control maize parthenogenetic haploid induction Zmpla1 / Zmmtl and Zm The haploid induction line of the above-mentioned anthocyanin-enriched material is crossed, and segregated offspring are obtained by self-crossing or backcrossing. Finally, molecular markers are used to detect single plants that also contain homozygous major genes, and parthenogenetic haploids are obtained. body induction system. The parthenogenetic haploid induction line of the present invention can realize the early identification and direct identification of haploid immature embryos, significantly improve the identification efficiency of haploid immature embryos, and simultaneously realize the identification of haploids in different growth periods. Breeding efficiency provides a feasible solution.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a rapid chromogenic parthenogenetic haploid induction line and its application in distinguishing maize haploid. Background technique [0002] As one of the important technologies to improve breeding efficiency, maize haploid breeding technology has been widely used in commercial maize breeding (Andorf C, et al. 2019.). Maize haploid breeding technology mainly includes four parts: haploid induction, identification, doubling and DH evaluation (Chen Shaojiang et al. 2012). Among them, the identification of haploids has attracted wide attention as a direct way to obtain haploids. How to efficiently select haploid immature embryos in the early stage of embryo development (about 15 days after pollination) is a technical problem for tissue culture doubling haploids. At present, the most practical haploid identification methods mainly include color marking identification...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A01H1/02A01H5/10A01H5/12A01H5/06A01H6/46C12Q1/6895
CPCA01H1/02A01H5/06A01H5/10A01H5/12A01H6/4684C12Q1/6895C12Q2600/156C12Q2600/172
Inventor陈茹梅陈绍江李建生柳小庆陈琛马帅刘晨旭
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI