Unlock instant, AI-driven research and patent intelligence for your innovation.

Targeting extracellular vesicle as well as preparation method and application thereof

A targeted, cellular technology, applied in cell dissociation methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve problems such as limited methods, achieve high drug loading rate, good biocompatibility, The effect of increasing the therapeutic activity

Pending Publication Date: 2021-10-22
SHAANXI NORMAL UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still limited methods to enable EVs to precisely carry drugs to targeted delivery sites.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting extracellular vesicle as well as preparation method and application thereof
  • Targeting extracellular vesicle as well as preparation method and application thereof
  • Targeting extracellular vesicle as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] One, a method for preparing extracellular vesicles expressing PDGFA small peptides on the membrane surface, specifically comprising the steps of:

[0061] S1, the acquisition of the targeting ligand PDGFA: select the cDNA library of adult mouse nerve tissue as a template, design the forward primer (F primer) and reverse primer (R primer) of the PDGFA gene, the nucleotide sequence of the F primer As shown in SEQ ID NO.4, the nucleotide sequence of the R primer is shown in SEQ ID NO.5, and the 5'-end and 3'-end obtained by PCR are XbaI and EcoRI restriction endonuclease sites respectively PDGFA fragments of dots;

[0062] SEQ ID NO.4: ACTTCTAGAATGAGGACCTGGGCTTGCCT

[0063] SEQ ID NO. 5: CTTGAATTCTCACCTCACATCTGTCTCCT

[0064] S2 was transformed with a commercial pCDH vector (purchased from System Biosciences, Palo Alto, USA), and the signal sequence (SS, a linear sequence that guides the directional transfer of proteins and has the function of a sorting signal) was inser...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological drug carrier preparation, and particularly discloses a targeting extracellular vesicle as well as a preparation method and application thereof. The method comprises the following steps: constructing an LV-Lc-PDGFA fusion expression lentiviral vector, infecting neural stem cells, constructing a stably transfected cell line NSC-LV-Lc-PDGFA, and positioning an expressed exogenous ligand PDGFA on the surface of an extracellular vesicle membrane, so that the targeting capability of the extracellular vesicles on the oligodendroglia lineage cells is improved. The extracellular vesicle with the membrane surface expressing the PDGFA small peptide has high targeting property, can be used as a drug carrier, and has a good treatment effect on demyelination diseases.

Description

technical field [0001] The invention relates to the technical field of biopharmaceutical carrier preparation, in particular to a targeted extracellular vesicle and its preparation method and application. Background technique [0002] Multiple sclerosis (MS) is a T-cell-mediated disease characterized by central nervous system (CNS) neuroinflammation and demyelination, affecting approximately 2.5 million people worldwide, with an incidence of It continues to increase. Experimental autoimmune encephalomyelitis (EAE) is the most commonly used animal model of MS to study its underlying mechanisms and provide a theoretical basis for the development of new MS treatments. [0003] Neural stem cells (NSCs) are highly efficient pluripotent cells with self-renewal ability and multilineage differentiation potential. In recent years, a large body of evidence has demonstrated that extracellular vesicles (EVs) harbor mRNA, miRNA, and proteins, which are believed to have the ability to in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10A61K47/46
CPCC12N15/86C12N5/0623C07K14/49A61K47/46C12N2740/15043C12N2800/107C12N2509/10C07K2319/02
Inventor 李星赵卓华张媛肖赟宋聖姣
Owner SHAANXI NORMAL UNIV