Supercharge Your Innovation With Domain-Expert AI Agents!

Application of poultry-derived chemotactic factor CCL19 in preparation of antiviral product

A chemokine and antiviral technology, applied in the field of biomedicine, can solve the problems of immune failure, affecting immune effect, bleeding, etc., and achieve the effect of inhibiting replication

Active Publication Date: 2022-04-26
HENAN INST OF SCI & TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology uses certain proteins from cysteines called CCL1s or their genes to create small particles with specific properties like antimicrobial activity which could be used against various types of bacteria such as salmonella spp., fowl litterbug disease caused by Salmosis, chickens' dysfunction syndrome, etc.. These tiny particles were shown effective at controlling these harmful microorganisms without causing any negative side effect on humans being raised around them.

Problems solved by technology

This patents discusses various chemical agents called chemokincs, including interleukin-8, IL-18, LFN-1, GM1 , CRP-25, SCF, CTCA, BCAM, CEACS, ENA-78, PAR-17, FKBP-12, CFTR, CD146, VEGI, ICE, ICOS, IFITA, SMRT, MRSA, etc., each playing a crucial part during specific stages of these processes involving cell movement and communication within blood vessels. These compounds help regulate gene expression and activity levels for certain types of white bloodcells like neutrocyte mononuclear phosphate stimulated smooth muscle contractions associated with autoimmunity and inflammations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of poultry-derived chemotactic factor CCL19 in preparation of antiviral product
  • Application of poultry-derived chemotactic factor CCL19 in preparation of antiviral product
  • Application of poultry-derived chemotactic factor CCL19 in preparation of antiviral product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Construction of pEGFP-N1 / CCL19 eukaryotic vector

[0029] The whole gene sequence of poultry CCL19 (Accession no.: NM_001302168.1) is shown in SEQ ID No.1.

[0030] According to the results of CCL19 sequencing, a pair of eukaryotic expression primers were designed (wherein, the bases underlined are the introduced restriction sites, and the Kozak sequence "GCCACC" for promoting expression was also introduced in CCL19-N1-F):

[0031] CCL19-N1-F (SEQ ID No. 2):

[0032] 5'CCG AAGCTT GCCACCATGCAGCGGCTGCACGTT 3'

[0033] CCL19-N1-R (SEQ ID No. 3):

[0034] 5'CCG GGATCC CTAATTGCCTTGATTTGGGAC 3'.

[0035] Respectively introduce restriction sites Hind III and BamH I into the upstream and downstream of the primers, and use the prepared prokaryotic vector pMDT / CCL19 (see Wang Qiuxia, Li Pengxiang, Li Yin, Liu Xingyou, Yu Yan, Zhang Yanhong, Jiang Jinqing, Ma Jinyou, Ou Changbo. Expression and purification of avian CCL19 protein and preparation of antibody. Chine...

Embodiment 2

[0038] Example 2 In vitro antiviral effect of CCL19

[0039] The DF-1 cells transfected for 24 hours were used for challenge test with IBDV strain (the virus strain is the B87 poisoned vaccine strain, purchased from Qingdao Weilan Biological Products Co., Ltd.), and a blank control and a negative challenge control were set up. In simple terms, the measured TCID 50 , select a certain multiple of diluted virus solution, and cover the wells of cells transfected for 24 hours and the wells of negative control cells in an amount of 200 μL per well, at 37°C CO 2 Incubate in an incubator for 1 hour, remove the virus liquid, and replace it with a culture medium containing 2% FBS to continue culturing.

[0040]Cell samples collected at different times were taken, and total RNA was extracted using a kit according to the instructions. After reverse transcription, the SYBR Green Master Mix kit was used to amplify the IBDV VP2 gene, and β-actin was used as an internal reference gene. The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses application of an avian chemotactic factor CCL19 in preparation of an antiviral product. Tests show that after cells are transfected by the CCL19 eukaryotic expression plasmid, replication of poultry viruses can be effectively inhibited, and then the application of the poultry-derived chemotactic factor CCL19 or the coding gene of the poultry-derived chemotactic factor CCL19 or a biological material containing the coding gene of the poultry-derived chemotactic factor CCL19 in preparation of antiviral products is provided. The invention provides a new way for prevention and control of poultry virus diseases.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner HENAN INST OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More