Application of poultry-derived chemotactic factor CCL19 in preparation of antiviral product
A chemokine and antiviral technology, applied in the field of biomedicine, can solve the problems of immune failure, affecting immune effect, bleeding, etc., and achieve the effect of inhibiting replication
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Construction of pEGFP-N1 / CCL19 eukaryotic vector
[0029] The whole gene sequence of poultry CCL19 (Accession no.: NM_001302168.1) is shown in SEQ ID No.1.
[0030] According to the results of CCL19 sequencing, a pair of eukaryotic expression primers were designed (wherein, the bases underlined are the introduced restriction sites, and the Kozak sequence "GCCACC" for promoting expression was also introduced in CCL19-N1-F):
[0031] CCL19-N1-F (SEQ ID No. 2):
[0032] 5'CCG AAGCTT GCCACCATGCAGCGGCTGCACGTT 3'
[0033] CCL19-N1-R (SEQ ID No. 3):
[0034] 5'CCG GGATCC CTAATTGCCTTGATTTGGGAC 3'.
[0035] Respectively introduce restriction sites Hind III and BamH I into the upstream and downstream of the primers, and use the prepared prokaryotic vector pMDT / CCL19 (see Wang Qiuxia, Li Pengxiang, Li Yin, Liu Xingyou, Yu Yan, Zhang Yanhong, Jiang Jinqing, Ma Jinyou, Ou Changbo. Expression and purification of avian CCL19 protein and preparation of antibody. Chine...
Embodiment 2
[0038] Example 2 In vitro antiviral effect of CCL19
[0039] The DF-1 cells transfected for 24 hours were used for challenge test with IBDV strain (the virus strain is the B87 poisoned vaccine strain, purchased from Qingdao Weilan Biological Products Co., Ltd.), and a blank control and a negative challenge control were set up. In simple terms, the measured TCID 50 , select a certain multiple of diluted virus solution, and cover the wells of cells transfected for 24 hours and the wells of negative control cells in an amount of 200 μL per well, at 37°C CO 2 Incubate in an incubator for 1 hour, remove the virus liquid, and replace it with a culture medium containing 2% FBS to continue culturing.
[0040]Cell samples collected at different times were taken, and total RNA was extracted using a kit according to the instructions. After reverse transcription, the SYBR Green Master Mix kit was used to amplify the IBDV VP2 gene, and β-actin was used as an internal reference gene. The ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com