Pseudomonas aeruginosa as well as construction method and application thereof

A technology of Pseudomonas aeruginosa and strains, applied in the field of genes, can solve problems such as no production correlation, and achieve the effect of increasing the production of rhamnolipids, improving the utilization rate of glycerol, and increasing production

Pending Publication Date: 2022-05-06
WANHUA CHEM (SICHUAN) CO LTD +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are no studies on the correlation between nadE gene and rhamnolipid production in Pseudomonas aeruginosa

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudomonas aeruginosa as well as construction method and application thereof
  • Pseudomonas aeruginosa as well as construction method and application thereof
  • Pseudomonas aeruginosa as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1: Construction of pUCP18-nadE vector

[0046]1. Use the genomic DNA of Pseudomonas aeruginosa KT1115 as a template, and use nadE-F and nadE-R as primers to perform PCR amplification to obtain a fragment containing the nadE gene. The nadE gene is shown in SEQ ID NO:3. The amino acid sequence of NAD+ synthetase encoded by nadE gene is shown in SEQ ID NO:4.

[0047] nadE-F: 5'-acgacggccagtgcc aagctt ATGCAACAGATCCAACGCG-3' (SEQ ID NO: 1)

[0048] The underlined sequence in SEQ ID NO:1 is the HindⅢ restriction enzyme recognition site;

[0049] nadE-R: 5'-tatgaccatgattac gaattc TCAGGGCGCCTTCGGCAG-3' (SEQ ID NO: 2)

[0050] The underlined sequence in SEQ ID NO: 2 is the recognition site for EcoRI digestion.

[0051] SEQ ID NO: 3:

[0052] ATGCAACAGATCCAACGCGACATCGCCCAAGCCCTGCAGGTCCAGCCGCCGTTCCAGTCGGAGGCCGACGTGCAGGCGCAGATCGCCCGGCGCATCGCCTTCATCCAGCAGTGCCTGAAGGATTCCGGGCTGAAGACCCTGGTGCTGGGGATCAGCGGCGGCGTCGACTCGCTCACCGCCGGCCTGCTGGCCCAGCGCGCCGTCGAGCAACTGCGCGAGCAG...

Embodiment 2

[0063] Embodiment 2: Construction of nadE gene overexpression strain KT1115-nadE

[0064] 1. Preparation of Pseudomonas aeruginosa KT1115 competent cells

[0065] (1) Pseudomonas aeruginosa KT1115 was inoculated in 2 mL of LB medium, and cultivated overnight at 30° C. and 200 rpm;

[0066] (2) According to the inoculum size of 1%, transfer the bacterial solution obtained in step (1) to 50mL LB medium, and cultivate it at 30°C and 200rpm until the OD600 is about 0.6;

[0067] (3) Centrifuge the bacterial solution obtained in step (2) at 8000 rpm and 4°C for 10 min, and take the supernatant;

[0068] (4) Resuspend the supernatant with 30mL pre-cooled 300mM sucrose solution, and wash 2-3 times;

[0069] (5) Finally, 0.5 mL of 300 mM sucrose solution was added to redissolve to complete the preparation of Pseudomonas aeruginosa KT1115 competent cells.

[0070] 2. Electrotransformation of Pseudomonas aeruginosa KT1115

[0071] (1) Take about 500ng of pUCP18-nadE vector and 100μL...

Embodiment 3

[0076] Embodiment 3: KT1115-nadE fermentation produces rhamnolipid

[0077] Fermentation medium composition: glycerin 40-100g / L, sodium nitrate 7.5g / L, peptone 5.0g / L, dipotassium hydrogen phosphate 2.5g / L, disodium hydrogen phosphate 2.5g / L, magnesium sulfate 0.5g / L, Calcium chloride 0.5g / L, the balance is water.

[0078] Pick a single colony of the recombinant bacterium KT1115-nadE obtained in Example 2 and inoculate it into 5 mL of LB medium at 30 ° C and 200 rpm for 12 hours to obtain a seed solution, and then inoculate 50 mL of the base with different contents according to the inoculum size of 6%. Carbon source in the fermentation medium, OD 600 0.3, 30°C, 200rpm shaking culture for 2 days, add IPTG with a final concentration of 1mM to induce the expression of NAD+ synthase, continue to ferment until the 7th day, end the fermentation, centrifuge at 8000rpm at room temperature for 10min, take the supernatant, and use the anthrone method to determine the supernatant The r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pseudomonas aeruginosa as well as a construction method and application thereof. The invention discloses a pseudomonas aeruginosa recombinant bacterium which is used for overexpressing NAD (Nicotinamide Adenine Dinucleotide) + synthetase. The invention provides a new development strategy for producing rhamnolipid by using microorganisms through glycerol fermentation.

Description

technical field [0001] The invention belongs to the field of gene technology, and relates to a strain of Pseudomonas aeruginosa and its construction method and application. Background technique [0002] Rhamnolipid is a kind of glycolipid anionic surfactant produced by Pseudomonas. It has the same emulsifying, wetting, foaming and other properties as chemical surfactants, and it is also healthy, non-toxic and green. It is one of the most mature and in-depth biosurfactants currently researched. It is widely used in oil exploration, sewage sludge treatment, soil remediation, agricultural production, daily washing products, cosmetics, food and medicine, etc. [0003] NADH (reduced nicotinamide adenine dinucleotide) plays an important role in maintaining cell growth, differentiation, energy metabolism and cell protection, and adjusting the concentration of NADH in microbial cells can directional improve the overall metabolic level of microbial cells , increase the consumption ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/52C12N15/78C12P19/44C12R1/385
CPCC12N9/93C12Y603/01005C12N15/78C12P19/44
Inventor张稳王竞辉黄真真杨付伟姜西娟石森孔令晓黎源
OwnerWANHUA CHEM (SICHUAN) CO LTD