Application of OsREP3 gene in controlling drought resistance of rice

A drought resistance, rice technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problem of difficulty in researching the contribution of drought avoidance, and achieve the effect of enhancing the ability to tolerate drought stress.

Pending Publication Date: 2022-06-03
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the contribution of roots to drought avoidance has been difficult to study because the roots are deeply buried in the soil.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsREP3 gene in controlling drought resistance of rice
  • Application of OsREP3 gene in controlling drought resistance of rice
  • Application of OsREP3 gene in controlling drought resistance of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Acquisition of target gene OsREP3

[0026] The applicant conducted a genome-wide association analysis of 529 core germplasm materials under normal conditions at maturity and root traits after drought stress, and located a gene that controls the maximum root length (MRLN) under normal conditions at maturity on chromosome 4. locus, within 200KB of this locus, most genes are annotated as transposons and retrotransposons in the rice genome annotation website TIGR (http: / / rice.plantbiology.msu.edu / ), Only a few genes were annotated as hypothetical or expressed proteins. These expressed proteins were analyzed in the expression profile database RiceXPRO (http: / / ricexpro.dna.affrc.go.jp / ), and it was found that one gene had strong root-specific expression characteristics. Therefore, we took this gene as our candidate gene for candidate research, which was named OsREP3. OsREP3 is functionally annotated as expressionprotein on the rice genome annotation website TIG R...

Embodiment 2

[0027] Example 2: Detection of the expression level of rice endogenous OsREP4 gene

[0028] The tissue expression profile of OsREP3 was detected by real-time fluorescence quantitative PCR ( figure 1 ). Specifically: the applicant selected the japonica rice variety "Zhonghua 11" (abbreviated as ZH11, a commercial variety from the Crop Research Institute of the Chinese Academy of Agricultural Sciences) as the material for expression profile analysis. The RNA samples of representative tissue materials in the tillering stage were taken, and the total RNA was extracted with TRIZOL reagent (purchased from Invitrogen Company). Transcribe and synthesize cDNA (method according to the instructions of Invitrogen reverse transcriptase reagent), and the reaction conditions are: 65°C for 5 minutes, 50°C for 60 minutes, and 70°C for 10 minutes. Taking the cDNA synthesized by the above reverse transcription as a template, the OsREP3 gene was amplified by specific PCR with primers (OsREP3Rea...

Embodiment 3

[0031] Example 3: Construction of OsREP3 gene knockout vector

[0032] Construction of CRISPR Knockout Vectors:

[0033] The applicant knocked out the OsREP3 gene in rice. The relevant CRISPR knockout vector construction methods are as follows:

[0034] The CRISPR knockout vector used was pRGEB32 (Xie, 2015, Boosting CRISPR / Cas9 multiplexediting capability with the endogenous tRNA-processing system). The gRNA was designed according to the method used in the literature and its secondary structure was predicted on the corresponding website. 2 targets were designed in the CDS region ( Image 6 ), the target sites selected in the CRISPR-P v2.0 website are as follows:

[0035] Target site 1: TCTCATCCTCGCAATGGTCA

[0036] Target site 2: CCGGGGAGTGGCCATGACAT.

[0037] The two gRNAs were ligated together overnight by T7 ligase, and 1 ul of the ligation product was taken and carried out with universal primers at both ends (S5A D5-F: 5'-CGGGTCTCAGGCAGGATGGGCAGTCTGGGCA-3' and S5AD5-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of rice gene engineering. The invention specifically discloses application of the OsREP3 gene in controlling drought resistance of rice, the nucleotide sequence of the OsREP3 gene is shown as SEQ ID NO: 1, and the sequence of the protein coded by the OsREP3 gene is shown as SEQ ID NO: 2. According to the invention, a candidate gene OsREP3 for regulating and controlling the root length is positioned by carrying out whole genome association analysis on mature-period root traits on rice germplasm resource materials, and a gene knockout material can obviously improve the root length and drought resistance of transgenic rice; the function of the gene and the application approach of the gene in drought-resistant genetic improvement of crops are proved.

Description

technical field [0001] The present invention relates to the field of rice genetic engineering. Specifically, it involves isolation, cloning and functional verification to obtain a rice OsREP3 gene that can regulate drought tolerance and its application in the genetic improvement of rice drought resistance. The nucleotide sequence of the OsREP3 gene is shown in SEQ ID NO: 1, and the sequence of the encoded protein is shown in SEQ ID NO: 2. Background technique [0002] For nearly a century, climate change has been drastic and the loss of arable land has intensified, but with the rapid growth of the global population, food shortage-related problems remain to be solved (Godfray et al 2010). Rice, one of the three major food crops, feeds nearly one-third of the world's population. The task of increasing rice yield is imminent. However, at present, the maximum yield potential of rice per unit of arable land has reached a certain bottleneck, and with the deterioration of the en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/06A01H6/46
CPCC07K14/415C12N15/8218C12N15/8261C12N15/8273
Inventor熊立仲吴远名李晓凯肖本泽
OwnerHUAZHONG AGRI UNIV