Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting apoptosis

A detection kit and apoptosis technology, applied in the field of kits for detection of cell apoptosis, can solve the problems of high price, high expression difficulty and high GC content in the coding region.

Inactive Publication Date: 2004-11-24
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The kit is expensive, and the 5' coding region of the Annexin V gene has a high GC content, so it is difficult to obtain high expression in expression systems such as Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting apoptosis
  • Kit for detecting apoptosis
  • Kit for detecting apoptosis

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0024] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS: Below in conjunction with the accompanying drawings, the present invention will be described in detail.

[0025] 1. Preparation of Annexin B1 protein:

[0026] 1. Construction of heat-inducible prokaryotic expression plasmid pJLA-Annexin B1

[0027] Two PCR primers were designed according to Annexin B1 cDNA sequence. Forward primer: 5'C CATATG GCCTACTGTCGCTCCCTGGTTC3', wherein the Nde I restriction site "CATATG" contains the initiation codon "ATG". The reverse primer is: 5'GC GGATCC TATTATGCAGGGCCGATGAGTTTCAAG3', which contains the BamH I restriction site "GGATCC" and the stop codon "TAA". The target gene plasmid PUC-Annexin B1 was used as a template for PCR amplification. The amplified product was confirmed to be completely correct by Genecore sequencing, and the Annexin B1 DNA fragment was purified by conventional methods, and double-digested with Nde I and BamH I, respectively, and then directional cloned into...

Embodiment 1

[0061] Example 1: Preparation of fluorescently labeled protein Annexin B1-FITC

[0062] Take out the frozen engineering bacteria XL1-Blue (pJLA-Annexin B1) from the -80°C refrigerator and thaw at room temperature, use an inoculation loop to dip a small amount of bacterial solution and inoculate it on 1.5% LB agar plates containing 100 μg / ml ampicillin. After culturing overnight at 28°C, take a single clone and inoculate it in 100ml of LB culture solution containing 100μg / mL ampicillin, which contains 1% tryptone, 0.5% yeast extract and 1% sodium chloride, pH7.0.28 Cultivate at ℃ for 12 hours, and serve as seed solution. The seed solution was inoculated into 1 liter of LB culture solution containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 30°C for 2 hours, place the Erlenmeyer shaker flask in a hot water bath at 70°C to quickly heat up to 42°C, and then place it at 42°C for 5 hours with shaking for heat induction.

[0063]The bacterial liquid after heat-in...

Embodiment 2

[0064] Example 2: Detection of apoptosis

[0065] Young mouse thymocytes were selected, and the apoptosis-inducing agent was dexamethasone. Take 2-3 weeks old Balb / c mice, and take thymus aseptically after eyeball bleeding to death, routinely prepare single cell suspension, count and adjust the cells to 1×10 6 pieces / ml. Put 5ml of thymocyte liquid in a culture dish, add dexamethasone to a final concentration of 10 -5 mol / L. Both control and induction groups were placed in CO 2 Culture in an incubator at 37°C, collect cells after 5 hours, wash cells twice with 1×PBS, resuspend cells with 1×binding buffer, adjust the number of cells to 1×10 6 pieces / ml. Aspirate 100 μl of cell suspension, add 5 μl of 20 μg / ml Annexin B1-FITC, 10 μl of PI solution, mix the reaction system gently at room temperature in the dark for 15 minutes, add 400 μl of binding buffer to each tube, and send it to flow cytometer for analysis. The result is as image 3 As shown, the apoptotic cells in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

A reagent kit for detecting cell wither features that its detecting protein is Annexin B1 instead of current Annexin V, resulting in high expression in colibacillus. Its other advantages are high speed and high sensitivity.

Description

Technical field: [0001] The invention relates to the technical field of medical detection reagents, and is a kit for detecting cell apoptosis. Background technique: [0002] Apoptosis is an important part of the cell life cycle. It is a process of automatic cell death regulated by genes that is different from cell death. It plays a very important role in processes such as spontaneous suppression of tumor cells. The main features of apoptosis are cell shrinkage, changes in cell membrane structure, dense nuclear chromatin, and endogenous nuclease-induced DNA degradation. Corresponding detection methods include morphological methods; methods to reflect changes in apoptotic cell membranes, such as the Annexin V detection kit imported from abroad; methods to reflect regular DNA fragmentation, such as DNA end labeling. Among them, the Annexin V detection method is designed for the earliest characteristics of apoptosis. In the early stage of apoptosis, the cell has lost the symm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68G01N33/68
Inventor 孙树汉张毅王芳郭瀛军颜宏利
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com