Kit for detecting apoptosis
A technology for detecting kits and cells, applied in the field of kits for detecting cell apoptosis, can solve the problems of high price, high GC content in the coding region, difficult high expression and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0026] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS: Below in conjunction with the accompanying drawings, the present invention will be described in detail.
[0027] 1. Preparation of Annexin B1 protein:
[0028] 1. Construction of heat-inducible prokaryotic expression plasmid pJLA-Annexin B1
[0029] Two PCR primers were designed according to Annexin B1 cDNA sequence. Forward primer: 5'C CATATG GCCTACTGTCGCTCCCTGGTTC3', wherein the Nde I restriction site "CATATG" contains the initiation codon "ATG". The reverse primer is: 5'GC GGATCC TATTATGCAGGGCCGATGAGTTTCAAG3', which contains the BamH I restriction site "GGATCC" and the stop codon "TAA". The target gene plasmid PUC-Annexin B1 was used as a template for PCR amplification. The amplified product was confirmed to be completely correct by Genecore sequencing, and the Annexin B1 DNA fragment was purified by conventional methods, and double-digested with Nde I and BamH I, respectively, and then directional cloned into...
Embodiment 1
[0065] Example 1: Preparation of fluorescently labeled protein Annexin B1-FITC
[0066] Take out the frozen engineered bacteria XL1-Blue (pJLA-Annexin B1) from the -80°C refrigerator and thaw at room temperature, dip a small amount of bacterial solution with an inoculation loop and inoculate it on a 1.5% LB agar plate containing 100 μg / ml ampicillin. After culturing overnight at 28°C, take a single clone and inoculate it in 100ml of LB culture solution containing 100μg / mL ampicillin, which contains 1% tryptone, 0.5% yeast extract and 1% sodium chloride, pH7.0.28 Cultivate at ℃ for 12 hours, and serve as seed solution. The seed solution was inoculated into 1 liter of LB culture solution containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 30°C for 2 hours, place the Erlenmeyer shaker flask in a hot water bath at 70°C to quickly heat up to 42°C, and then place it at 42°C for 5 hours with shaking for heat induction.
[0067]The bacterial liquid after heat-indu...
Embodiment 2
[0068] Example 2: Detection of apoptosis
[0069] Young mouse thymocytes were selected, and the apoptosis-inducing agent was dexamethasone. Take 2-3 weeks old Balb / c mice, and take thymus aseptically after eyeball bleeding to death, routinely prepare single cell suspension, count and adjust the cells to 1×10 6 pieces / ml. Put 5ml of thymocyte liquid in a culture dish, add dexamethasone to a final concentration of 10 -5 mol / L. Both control and induction groups were placed in CO 2 Culture in an incubator at 37°C, collect cells after 5 hours, wash cells twice with 1×PBS, resuspend cells with 1×binding buffer, adjust the number of cells to l×10 6 pieces / ml. Aspirate 100 μl of cell suspension, add 5 μl of 20 μg / ml Annexin B1-FITC, 10 μl of PI solution, mix the reaction system gently at room temperature in the dark for 15 minutes, add 400 μl of binding buffer to each tube, and send it to flow cytometer for analysis. The result is as image 3 As shown, the apoptotic cells in th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 