Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cell transfecting formulations of small interfering RNA related compositions and methods of making and use

a technology of interfering rna and cell transfection formulation, which is applied in the direction of transferases, drug compositions, genetic material ingredients, etc., can solve the problems of non-specific cleavage of mrna by a ribonuclease, safety problems, and technical difficulties encountered in transfecting sirna into cells, and achieve efficient delivery

Inactive Publication Date: 2006-01-26
CHIRON CORP
View PDF10 Cites 85 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0025] The compositions of the invention result in efficient delivery of the biologically active siRNA to mammalian cells effective to knockout the mRNA of a target gene.

Problems solved by technology

One potential impediment to harnessing the RNAi phenomenon in mammalian cells is that the presence of long dsRNAs in these cells also stimulates an interferon response that results in non-specific cleavage of mRNA by a ribonuclease.
However, technical difficulties have been encountered in transfecting siRNA into cells.
Viral vectors provide relatively efficient delivery, but in some cases present safety problems due to the risk of immunological complications or unwanted propagation in the subject.
However, all of these vectors must be prepared by time-consuming recombinant DNA techniques.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell transfecting formulations of small interfering RNA related compositions and methods of making and use
  • Cell transfecting formulations of small interfering RNA related compositions and methods of making and use
  • Cell transfecting formulations of small interfering RNA related compositions and methods of making and use

Examples

Experimental program
Comparison scheme
Effect test

example 1

SiRNA Inhibition of Target mRNA

[0206] A. Preparation of Transfection Mixture

[0207] For each transfection mixture (which are examples of compositions in accordance with the present invention), a lipitoid or lipitoid / cholesteroid combination delivery vehicle was prepared to a working concentration of 0.5 mM in water and mixed to yield a uniform solution. The siRNA was prepared to a working concentration of 20 μM in buffer supplied with the siRNAs. In this example, the siRNAs were for Akt1 mRNA and had the sequence CAUAGUGAGGUUGCAUCUGGUG (SEQ ID No: 1) with two 2′ O-methyl UU (RNA) nucleotide 3′-overhangs and phosphodiester links throughout (available from Integrated DNA Technologies). The siRNA was diluted in OptiMEM™ (Gibco / BRL), in a microfuge tube, to 1 μM, or approximately 15 μg oligo / ml of OptiMEM™. In a separate microfuge tube, vehicle, typically in the amount of about 3.75 mmol vehicle / 100 pmol siRNA, was diluted into the same volume of OptiMEM™ used to dilute the siRNA. In t...

example 2

Loss of Luciferase Activity After siRNA Transfection

[0211] Transfection mixtures were prepared using siRNA against firefly luciferase (CGUACGCGGAAUACUUCGA (SEQ ID No: 2); from Elbashir et al., Nature, 411, 494 (2001)) and several different delivery vehicles in accordance with the present invention as described herein (L1, L2, L1 / C1, L4 1L1 / 3C1) substantially as described in Example 1. Luciferase activity was quantified with the Promega Dual-Luciferase Reporter Assay System according to package directions. As shown in FIG. 3, luciferase activity in MDA231 stably expressing luciferase was substantially reduced after transfection of an siRNA against luciferase. The control was a non-transfected cell line. This result provides further indication of the capability of compositions in accordance with the present invention for the effective delivery of siRNA to cells.

example 3

Knockout of Akt1 Message in Cells Transfected with siRNA

[0212] Table 1 shows data for an experiment undertaken to compare the effectiveness of the knockout of Akt1 message in cells transfected with siRNAs by a composition incorporating a combination lipitoid / cholesteroid delivery vehicle in accordance with the present invention and using a commercially available transfection agent (Fugene6, available from Roche. HT1080 cells were transfected with 100 nM of two different siRNAs (siRNA directed against Akt1 messenger RNA having the sequence CAUAGUGAGGUUGCAUCUGGUG (SEQ ID No: 1) with two TT nucleotide 3′-overhangs and phosphodiester links throughout or with two 2′ O-methyl UU (RNA) nucleotide 3′-overhangs and phosphodiester links throughout) using a composition incorporating a combination lipitoid / cholesteroid delivery vehicle 1L1 / 3C3) substantially according to the transfection mixture preparation and transfection procedures described in Example 1. Reduction in mRNA levels of about 6...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

Compositions incorporating small interfering ribonucleic acid (siRNA) and certain lipid-conjugated polyamide compound-based delivery vehicles that are particularly useful in the delivery siRNA and other polynucleotides to cells. Also, methods of making and using the compositions.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No. 60 / 530,953, filed Dec. 19, 2003, which is hereby incorporated herein in its entirety.FIELD OF THE INVENTION [0002] This invention relates to compositions incorporating small interfering ribonucleic acid (siRNA) with lipid-conjugated polyamide compounds, methods for making them, as well as methods for their use in the delivery of siRNA to cells. The invention also relates to a novel class of lipid-conjugated polyamide compounds suitable for use in the delivery of polynucleotides, including siRNA, to cells BACKGROUND OF THE INVENTION [0003] RNA interference refers to the phenomenon of the presence of double stranded RNA in a cell eliminating the expression of a gene having the same sequence, while leaving the expression of other unrelated genes undisturbed. This phenomenon, also known as “post transcriptional gene silencing” or “RNA silencing” has been noted in plants...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K48/00C12N15/11C12N15/113C12N15/87
CPCA61K48/00A61K47/44C12N15/111C12N15/1137C12N15/87C12N15/88C12N2310/14C12N2310/321C12N2320/32C12Y207/01037C07H21/04A61K31/7088A61K47/48C12N15/113A61K47/48807C12N2310/3521A61K47/6909A61P35/00A61P43/00
Inventor BURKOTH, TIMOTHYJEFFERSON, ANNEREINHARD, CHRISTOPHZUCKERMANN, RONALD
Owner CHIRON CORP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More