Cell transfecting formulations of small interfering RNA related compositions and methods of making and use
a technology of interfering rna and cell transfection formulation, which is applied in the direction of transferases, drug compositions, genetic material ingredients, etc., can solve the problems of non-specific cleavage of mrna by a ribonuclease, safety problems, and technical difficulties encountered in transfecting sirna into cells, and achieve efficient delivery
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
SiRNA Inhibition of Target mRNA
[0206] A. Preparation of Transfection Mixture
[0207] For each transfection mixture (which are examples of compositions in accordance with the present invention), a lipitoid or lipitoid / cholesteroid combination delivery vehicle was prepared to a working concentration of 0.5 mM in water and mixed to yield a uniform solution. The siRNA was prepared to a working concentration of 20 μM in buffer supplied with the siRNAs. In this example, the siRNAs were for Akt1 mRNA and had the sequence CAUAGUGAGGUUGCAUCUGGUG (SEQ ID No: 1) with two 2′ O-methyl UU (RNA) nucleotide 3′-overhangs and phosphodiester links throughout (available from Integrated DNA Technologies). The siRNA was diluted in OptiMEM™ (Gibco / BRL), in a microfuge tube, to 1 μM, or approximately 15 μg oligo / ml of OptiMEM™. In a separate microfuge tube, vehicle, typically in the amount of about 3.75 mmol vehicle / 100 pmol siRNA, was diluted into the same volume of OptiMEM™ used to dilute the siRNA. In t...
example 2
Loss of Luciferase Activity After siRNA Transfection
[0211] Transfection mixtures were prepared using siRNA against firefly luciferase (CGUACGCGGAAUACUUCGA (SEQ ID No: 2); from Elbashir et al., Nature, 411, 494 (2001)) and several different delivery vehicles in accordance with the present invention as described herein (L1, L2, L1 / C1, L4 1L1 / 3C1) substantially as described in Example 1. Luciferase activity was quantified with the Promega Dual-Luciferase Reporter Assay System according to package directions. As shown in FIG. 3, luciferase activity in MDA231 stably expressing luciferase was substantially reduced after transfection of an siRNA against luciferase. The control was a non-transfected cell line. This result provides further indication of the capability of compositions in accordance with the present invention for the effective delivery of siRNA to cells.
example 3
Knockout of Akt1 Message in Cells Transfected with siRNA
[0212] Table 1 shows data for an experiment undertaken to compare the effectiveness of the knockout of Akt1 message in cells transfected with siRNAs by a composition incorporating a combination lipitoid / cholesteroid delivery vehicle in accordance with the present invention and using a commercially available transfection agent (Fugene6, available from Roche. HT1080 cells were transfected with 100 nM of two different siRNAs (siRNA directed against Akt1 messenger RNA having the sequence CAUAGUGAGGUUGCAUCUGGUG (SEQ ID No: 1) with two TT nucleotide 3′-overhangs and phosphodiester links throughout or with two 2′ O-methyl UU (RNA) nucleotide 3′-overhangs and phosphodiester links throughout) using a composition incorporating a combination lipitoid / cholesteroid delivery vehicle 1L1 / 3C3) substantially according to the transfection mixture preparation and transfection procedures described in Example 1. Reduction in mRNA levels of about 6...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


