Methods and compositions for predicting drug responses

a drug response and composition technology, applied in the field of methods and compositions for predicting drug responses, can solve the problems of drug doses being less effective than desired in some individuals, serious injury or even death, and powerful toxic effects in patients, and achieve the effect of determining the responsiveness of warfarin therapy

a drug response and composition technology, applied in the field of methods and compositions for predicting drug responses, can solve the problems of drug doses being less effective than desired in some individuals, serious injury or even death, and powerful toxic effects in patients, and achieve the effect of determining the responsiveness of warfarin therapy

US20060084081A1Inactive Publication Date: 2006-04-20UNIV OF WASHINGTON
0 Cites 23 Cited by

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and compositions for predicting drug responses
  • Methods and compositions for predicting drug responses
  • Methods and compositions for predicting drug responses

Examples

Experimental program
Comparison scheme
Effect test

example 1

VKORC1 Polymorphisms

[0130] This Example describes the association between VKORC1 polymorphisms and optimal Warfarin dosages.

A. Methods

Clinical and Control Subjects

[0131] The initial European American clinical patients used in this study have been previously described (Higashi et al., Jama 287, 1690-8 (2002)) as have most of the European American patients in the replication study (Gage et al., Thromb Haemost 91, 87-94 (2004)). All control DNA population samples were purchased from the human variation collections and the CEPH pedigree samples at the Coriell Cell Repository. The Asian American samples consisted of 96 individuals from the HD 100CHI panel (Han People of Los Angeles), 10 Southeast Asians (HD13), 7 Chinese (HD32), and 7 Japanese (from the HD07 panel). The 96 European American samples were selected from the HD100CAU panel with the remaining 23 individuals selected from the parental generation of the CEPH families (for more information on these samples see Table 4). T...

example 2

Expression of VKORC1 mRNA

[0150] To explore the mechanism of the association between warfarin dose and VKORC1 polymorphisms, VKORC1 mRNA levels were assayed in human liver tissue and compared with the major VKORC1 haplotype groups (A / A, A / B, B / B).

A. Methods

[0151] Assay of VKORC1 mRNA. 1.2 μL of total cDNA from each sample was used as template for the quantitative PCR (using 9 μL reactions) in the presence of SYBR green reporter (Applied Biosystems, Foster City, Calif.). PCR primers (5′ to 3′-forward=ATCAGCTGTTCGCGCGTC (SEQ ID NO:14), reverse=AGAGCACGAAGAACAGGATC (SEQ ID NO:15) were selected from sequences in exon 1 and 3 of the VKORC1 coding sequence (Accession No. NM—024006). All quantitative PCR was performed on an Applied Biosystems 7900HT and real-time data collected during the entire thermocycling period (cycling conditions: 95° C.-15 minutes for initial denaturation and 40 cycles of 94° C.-30 sec., 60° C.-30 sec, 72° C.-30 sec and a final extension of 72° C.-5 minutes). Ea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

The present invention relates to methods and compositions for predicting drug responses. In particular, the present invention provides methods and compositions for determining individualized Warfarin dosages based on the level of expression of the VKORC1 gene.

Description

[0001] This application is a continuation in part of co-pending application Ser. No. 10 / 967,879, filed Oct. 18, 2004, which is herein incorporated by reference in its entirety.[0002] This application was supported in part by NHLBI—Program for Genomic Applications (PGA) grant (U01 HL66682), Program for Genomic Applications (PGA) grant U01 HL66682, NIH General Medical Sciences grant GM068797 and UW NIEHS sponsored Center for Ecogenetics and Environmental Health, grant NIEHS P30ES07033. The government has certain rights in the invention.FIELD OF THE INVENTION [0003] The present invention relates to methods and compositions for predicting drug responses. In particular, the present invention provides methods and compositions for determining individualized Warfarin dosages based on the level of expression of the VKORC1 gene. BACKGROUND OF THE INVENTION [0004] More than 3 billion prescriptions are written each year in the U.S. alone, effectively preventing or treating illness in hundreds o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
20 Apr 2006
Publication
US20060084081A1
IPC
C12Q1/68; G01N33/53; C12P19/34
CPC
C12Q1/6876; C12Q1/6883; C12Q2600/156
Inventors
RIEDER, MARK; RETTIE, ALLAN