Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Methods and compositions for predicting drug responses

a drug response and composition technology, applied in the field of methods and compositions for predicting drug responses, can solve the problems of drug doses being less effective than desired in some individuals, serious injury or even death, and powerful toxic effects in patients, and achieve the effect of determining the responsiveness of warfarin therapy

Inactive Publication Date: 2006-04-20
UNIV OF WASHINGTON
View PDF0 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0010] For example, in some embodiments, the present invention provides a method, comprising: providing a sample from a subject; and determining the subject's VKORC1 expression level to determine responsiveness to Warfarin therapy. In some embodiments, the method further comprised the step of determining the subject's optimal Warfarin dose based on the subject's VKORC1 expression level. In certain embodiments, the method further comprises the step of determining said subject's CYP2C9 genotype. In some embodiments, determining the subject's VKORC1 expression level comprises determining the amount of VKORC1 mRNA expressed by said subject (e.g., by using a quantitative RT-PCR assay or a nucleic acid hybridization assay). In other embodiments, determining the subject's VKORC1 expression level comprises determining the amount of VKORC1 polypeptide expressed by the subject (e.g., by exposing the sample

Problems solved by technology

But prescription medications also can cause powerful toxic effects in a patient.
Adverse drug reactions can cause serious injury and or even death.
Differences in metabolism also cause doses of drugs to be less effective than desired in some individuals.
Adverse drug reactions are a severe, common and growing cause of death, disability and resource consumption.
This “one size fits all” method, however, does not consider important genetic differences that give different individuals dramatically different abilities to metabolize and derive benefit from a particular drug.
Genetic differences may be influenced by race or ethnicity, but may also be largely unpredictable without identifying correlating genomics.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and compositions for predicting drug responses
  • Methods and compositions for predicting drug responses
  • Methods and compositions for predicting drug responses

Examples

Experimental program
Comparison scheme
Effect test

example 1

VKORC1 Polymorphisms

[0130] This Example describes the association between VKORC1 polymorphisms and optimal Warfarin dosages.

A. Methods

Clinical and Control Subjects

[0131] The initial European American clinical patients used in this study have been previously described (Higashi et al., Jama 287, 1690-8 (2002)) as have most of the European American patients in the replication study (Gage et al., Thromb Haemost 91, 87-94 (2004)). All control DNA population samples were purchased from the human variation collections and the CEPH pedigree samples at the Coriell Cell Repository. The Asian American samples consisted of 96 individuals from the HD 100CHI panel (Han People of Los Angeles), 10 Southeast Asians (HD13), 7 Chinese (HD32), and 7 Japanese (from the HD07 panel). The 96 European American samples were selected from the HD100CAU panel with the remaining 23 individuals selected from the parental generation of the CEPH families (for more information on these samples see Table 4). T...

example 2

Expression of VKORC1 mRNA

[0150] To explore the mechanism of the association between warfarin dose and VKORC1 polymorphisms, VKORC1 mRNA levels were assayed in human liver tissue and compared with the major VKORC1 haplotype groups (A / A, A / B, B / B).

A. Methods

[0151] Assay of VKORC1 mRNA. 1.2 μL of total cDNA from each sample was used as template for the quantitative PCR (using 9 μL reactions) in the presence of SYBR green reporter (Applied Biosystems, Foster City, Calif.). PCR primers (5′ to 3′-forward=ATCAGCTGTTCGCGCGTC (SEQ ID NO:14), reverse=AGAGCACGAAGAACAGGATC (SEQ ID NO:15) were selected from sequences in exon 1 and 3 of the VKORC1 coding sequence (Accession No. NM—024006). All quantitative PCR was performed on an Applied Biosystems 7900HT and real-time data collected during the entire thermocycling period (cycling conditions: 95° C.-15 minutes for initial denaturation and 40 cycles of 94° C.-30 sec., 60° C.-30 sec, 72° C.-30 sec and a final extension of 72° C.-5 minutes). Ea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

The present invention relates to methods and compositions for predicting drug responses. In particular, the present invention provides methods and compositions for determining individualized Warfarin dosages based on the level of expression of the VKORC1 gene.

Description

[0001] This application is a continuation in part of co-pending application Ser. No. 10 / 967,879, filed Oct. 18, 2004, which is herein incorporated by reference in its entirety.[0002] This application was supported in part by NHLBI—Program for Genomic Applications (PGA) grant (U01 HL66682), Program for Genomic Applications (PGA) grant U01 HL66682, NIH General Medical Sciences grant GM068797 and UW NIEHS sponsored Center for Ecogenetics and Environmental Health, grant NIEHS P30ES07033. The government has certain rights in the invention.FIELD OF THE INVENTION [0003] The present invention relates to methods and compositions for predicting drug responses. In particular, the present invention provides methods and compositions for determining individualized Warfarin dosages based on the level of expression of the VKORC1 gene. BACKGROUND OF THE INVENTION [0004] More than 3 billion prescriptions are written each year in the U.S. alone, effectively preventing or treating illness in hundreds o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/53C12P19/34
CPCC12Q1/6876C12Q1/6883C12Q2600/156
Inventor RIEDER, MARKRETTIE, ALLAN
Owner UNIV OF WASHINGTON
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com