Methods and compounds for prevention and treatment of elevated intraocular pressure and related conditions

a technology of elevated intraocular pressure and compound, which is applied in the direction of drug compositions, peptides, cardiovascular disorders, etc., can solve the problems of peripheral vision loss and sometimes central vision loss

Inactive Publication Date: 2006-12-28
THERATECHONOLGIES INC
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glaucoma is characterized by optic nerve head excavation which can lead to loss of peripheral vision and sometimes loss of central vision.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and compounds for prevention and treatment of elevated intraocular pressure and related conditions
  • Methods and compounds for prevention and treatment of elevated intraocular pressure and related conditions
  • Methods and compounds for prevention and treatment of elevated intraocular pressure and related conditions

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning and Characterization of the Nucleic Acid Encoding R-14

[0198] In silico analysis of EST # HTM1-025F1 (GenBank Acc.: BE439409) against human genome using BLAST-N (v. 2.2.1) program resulted in a hit of 99.8% similarity to HTM1-025F1 in contig NT—009307.3, AC020568.4 on chromosome 11. A 966 bp fragment was amplified from a BAC clone, RP11-206Cl obtained from the Sanger Center, UK, by PCR, using gene specific primers, 5′GATTCAACCATCCCAGTCTTGGGTACAG3′ (SEQ ID NO: 6) and 5′TTACTGCTCCAATCTGCTTCCCGACAGC3′ (SEQ ID NO: 7). PCR was done using Taq HiFi (Invitrogen, Calif.) following the protocol suggested by the manufacturer (annealing at 60° C. for 30 sec, elongation at 68° C. for 80 sec: total cycles-35). The PCR products were separated using 1% agarose gels. A photograph of the gel is shown in FIG. 1(A). −Bac: No plasmid DNA; +Bac: contains plasmid DNA (0.1 μg); MW std: λ Hind III digest. The ˜960 bp fragment (indicated by arrow) was cloned into pcDNA4HisMax TOPO TA (Invitrogen, Cal...

example 2

Expression of R-14 mRNA in Human Trabecular Meshwork Tissue

[0201] Method: RT-PCR of total mRNA isolated from human trabecular meshwork (HTM) and human iris (HI) tissues. Aliquots of total RNA (1 μg) were reverse transcribed (50° C. for 30 min) and the reaction mixture was amplified for 35 cycles (60° C. for 30 sec) using gene-specific primers SuperScript One-Step RT-PCR (InVitrogen). Resolution of the PCR products by agarose gel electrophoresis showed a single DNA fragment of 1 Kb from HTM tissue, but not from iris tissue. Sequencing of the DNA fragment from HTM tissue identified the 1 Kb fragment to contain the R-14 reading frame.

example 3

Expression of Cloned Human R-14 Receptor in Human Cells

[0202] Cell culture: HEK293 cells were grown in complete DMEM (10% fetal calf serum, 0.1% Penicillin and streptomycin, 2 mM glutamine, 0.5ug / ml fungizone, 5ug / ml gentamicin) until −70% confluent. Cells were transfected using Lipofectamine 2000 (InVitrogen) according to the manufacturer's recommendations using 12.5 μg DNA and 25 μl Lipofectamine in DMEM. Media was replaced after 48 hours for complete DMEM (The cells were processed immediately to detect transient expression of R-14), supplemented with 500 μg / ml Zeocin. After 3 weeks in culture, the zeocin-resistant cells (R14 / 293) were split and cultured in complete DMEM with 100 μg / ml Zeocin.

[0203] Immunoblotting of R-14 proteins: Confluent cells were lysed in TNE (10 mM Tris-HCl pH 7.4, 0.1 mM EDTA, 0.85% NaCl, 1% NP-40) buffer containing protease inhibitor cocktail. Aliquots (100 μg protein) of supernatants were denatured in 50 μl of SDS-loading buffer by boiling for 5 minute...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
thermal melting pointaaaaaaaaaa
pKaaaaaaaaaaa
body temperatureaaaaaaaaaa
Login to view more

Abstract

A GPCR-like protein is described, as well as inhibitory / antagonistic compounds and compositions comprising such inhibitors / antagonists of the protein. Such compounds may be used for treating elevated intraocular pressure and conditions associated with elevated intraocular pressure, such as glaucoma.

Description

CROSS-REFERENCE TO RELATED APPLICATION [0001] This application claims the benefit of U.S. provisional application No. 60 / 367,513 filed Mar. 27, 2002.FIELD OF THE INVENTION [0002] The invention relates to methods and compounds for the prevention and / or treatment of ocular hypertension or elevated intraocular pressure, and related conditions such as glaucoma. BACKGROUND OF THE INVENTION Glaucoma and Intraocular Pressure [0003] Glaucoma is characterized by optic nerve head excavation which can lead to loss of peripheral vision and sometimes loss of central vision. Glaucoma is the second leading cause of vision loss worldwide; an estimated 66.8 million people will have primary glaucoma and 6.7 million will be bilaterally blind due to this disorder. In the United States, glaucoma is the second leading cause of permanent blindness and the leading cause among African Americans. While glaucoma is treatable and vision loss can be prevented, once vision loss occurs it is irreversible. Elevat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68G01N33/567C07H21/04C12P21/06C07K14/705A61K38/17A61K38/00A61P27/06C07K7/06C07K14/72
CPCA61K38/00C07K7/06G01N2800/166C07K14/723G01N2333/726C07K14/705A61P27/02A61P27/06
Inventor PERI, KRISHNAMOFFETT, SERGEABRAN, DANIEL
Owner THERATECHONOLGIES INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap