Method of producing antibodies

a technology of antibody and recombinant protein, which is applied in the field of producing antibodies, can solve the problems of difficult to obtain dna expression in cells, alterations and/or damage to the genomic dna of host cells, etc., and achieve the effects of increasing the efficiency of recombinantly expressed protein translation, and increasing the production of recombinantly expressed protein

Inactive Publication Date: 2013-09-19
MODERNATX INC
View PDF1 Cites 100 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0010]In one aspect, the disclosure features a method of increasing the production of a recombinantly expressed protein of interest in a cell, comprising the steps: (i) providing a target cell comprising a recombinant nucleic acid encoding the protein of interest; and (ii) introducing into the target cell a composition comprising a first isolated nucleic acid comprising a translatable region encoding a translation effector protein and a nucleoside modification under conditions such that the effector protein is produced in the cell, thereby increasing the production of the recombinantly expressed protein in the cell.

Problems solved by technology

There are multiple problems with prior methodologies of effecting protein expression.
Introduced DNA can integrate into host cell genomic DNA at some frequency, resulting in alterations and / or damage to the host cell genomic DNA.
Further, it is difficult to obtain DNA expression in cells; frequently DNA enters cells but is not expressed or not expressed at reasonable rates or concentrations.
This can be a particular problem when DNA is introduced into cells such as primary cells or modified cell lines.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of producing antibodies
  • Method of producing antibodies
  • Method of producing antibodies

Examples

Experimental program
Comparison scheme
Effect test

example 1

Synthesis of Modified mRNA

[0170]Modified mRNAs (modRNAs) according to the invention were made using standard laboratory methods and materials. The open reading frame (ORF) of the gene of interest is flanked by a 5′ untranslated region (UTR) containing a strong Kozak translational initiation signal and an alpha-globin 3′ UTR terminating with an oligo(dT) sequence for templated addition of a polyA tail. The modRNAs were modified with pseudouridine (ψ) and 5-methyl-cytidine (5meC) to reduce the cellular innate immune response. Kariko K et al. Immunity 23:165-75 (2005), Kariko K et al. Mol Ther 16:1833-40 (2008), Anderson B R et al. NAR (2010).

[0171]The cloning, gene synthesis and vector sequencing was performed by DNA2.0 Inc. (Menlo Park, Calif.). Vector sequences and insert sequences are set forth in SEQ ID NOs: 5-8. The ORFs were restriction digested using XbaI or HindIII and used for cDNA synthesis using tailed-PCR. This tailed-PCR cDNA product was used as the template for the modif...

example 2

De novo Generation of a Mammalian Commercial Production Cell Line Expressing Human G-CSF as a Therapeutic Agent in Model Bioreactor

[0176]The nucleic acid sequence for the precursor of human granulocyte colony stimulating factor (G-CSF) is set forth in SEQ ID NO: 1:

(SEQ ID NO: 1)agcttttggaccctcgtacagaagctaatacgactcactatagggaaataagagagaaaagaagagtaagaagaaatataagagccaccatggccggtcccgcgacccaaagccccatgaaacttatggccctgcagttgctgctttggcactcggccctctggacagtccaagaagcgactcctctcggacctgcctcatcgttgccgcagtcattccttttgaagtgtctggagcaggtgcgaaagattcagggcgatggagccgcactccaagagaagctctgcgcgacatacaaactttgccatcccgaggagctcgtactgctcgggcacagcttggggattccctgggctcctctctcgtcctgtccgtcgcaggctttgcagttggcagggtgcctttcccagctccactccggtttgttcttgtatcagggactgctgcaagcccttgagggaatctcgccagaattgggcccgacgctggacacgttgcagctcgacgtggcggatttcgcaacaaccatctggcagcagatggaggaactggggatggcacccgcgctgcagcccacgcagggggcaatgccggcctttgcgtccgcgtttcagcgcagggcgggtggagtcctcgtagcgagccaccttcaatcatttttggaagtctcgtaccgggtgctgagacatcttgcgcagccgtgaagcgctgccttctg...

example 3

De novo Generation of a Mammalian Commercial Production Cell Line Expressing Humanized IgG Antibodies (Trastuzumab and Rituximab) as a Therapeutic Agent in Model Bioreactor

[0180]The nucleic acid sequence for the Heavy Chain of Rituximab is set forth in SEQ ID NO: 4:

(SEQ ID NO: 4)CTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGCCGTGATGGCGCCGAGGACCCTGGTGCTCTTGCTCACGGGTGCCTTGGCCCTCACGCAAACATGGGCGGGACAGGCGTACTTGCAGCAGTCAGGGGCAGAACTCGTAAGGCCCGGAGCGTCGGTGAAGATGTCGTGTAAAGCGTCGGGCTATACTTTCACATCGTACAACATGCACTGGGTCAAACAGACGCCCCGACAAGGGCTGGAGTGGATTGGAGCTATCTACCCCGGTAACGGGGATACGTCGTACAACCAGAAGTTTAAGGGGAAGGCGACTCTTACTGTCGACAAGTCGTCCTCCACCGCCTATATGCAGCTGTCGAGCCTGACTTCGGAAGATTCAGCGGTGTACTTTTGTGCGCGCGTGGTCTATTACTCAAATTCGTATTGGTATTTCGATGTGTGGGGTACGGGGACCACTGTGACCGTGTCAGGACCCTCGGTATTCCCCCTCGCGCCTAGCTCAAAGTCCACCTCCGGGGGAACAGCCGCCTTGGGTTGCTTGGTAAAGGACTATTTCCCCGAGCCCGTCACAGTGAGCTGGAACTCCGGGGCACTGACATCGGGAGTGCACACGTTTCCCGCGGTACTTCAGTCATCAGGACTCTACTCGCTGTCAAGCGTGGTCACGGTGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided are compositions and methods for delivering biological moieties such as modified nucleic acids into cells to modulate protein expression. Such compositions and methods include the use of modified messenger RNAs, and are useful for production of proteins.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]The present application is a continuation of U.S. patent application Ser. No. 13 / 252,049, filed Oct. 3, 2011, entitled Engineered Nucleic Acids and Methods of Use Thereof which claims the benefit of U.S. Provisional Application No. 61 / 404,413, filed Oct. 1, 2010, the disclosure of each of which is considered part of (and is incorporated herein by reference in) the disclosure of this application.[0002]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled M008TR1SEQLST.tx created on May 17, 2013 which is 57,704 bytes in size. The information in electronic format of the sequence listing is incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION[0003]Naturally occurring R NAs are synthesized from four basic ribonucleotides: ATP, CTP, UTP and GTP, but may contain post-transcriptionally modified nucleotides. Further, approximately one h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C07K16/00
CPCC07K16/00C07H19/10C12P21/00C07H21/02C12N15/11C07K2317/24G01N33/559C12N5/0602C12N15/102C07K16/2887C12N15/1138C12N15/1136C12N2310/3341C12N2310/335A61K48/0066C12N15/67
InventorSCHRUM, JASON P.EJEBE, KENECHIELBASHIR, SAYDA M.
OwnerMODERNATX INC