Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit

A technology of RT-LAMP, Japanese encephalitis virus, applied in the biological field, can solve the problems of increased cost, inconvenience to carry, easy to pollute the environment, etc., and achieves the effects of low use cost, easy reaction results and high sensitivity

Inactive Publication Date: 2012-04-04
SOUTH CHINA AGRI UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of a turbidimeter not only increases the cost, but is also inconvenient to carry; some scholars use the method of adding SYBR Green I dye to the reacted system to detect the amplification product, but this observation must be opened for processing, LAMP amplification The high efficiency and high sensitivity make the product contain a large number of target fragments, and adding dyes after opening the cap is extremely easy to pollute the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit
  • Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit
  • Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] 1. Primer design

[0067] According to the principles of LAMP primer design, primer 5.0 was used to design a set of primers (as shown in Table 1) for the conserved region sequence of the JEV gene, including a pair of external primers (F3 and B3) and a pair of internal primers (FIP and BIP). FIP consists of F1c (complementary sequence of F1), TTT junction and F2 sequence; BIP consists of B1c (complementary sequence of B1), TTT junction and B2 sequence. Primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd. The synthesized primers were diluted with sterilized triple distilled water to a 10 pmol / μL solution and stored at -20°C.

[0068] AAGTTACTGCTATCATGCTTCAGTCACTGACATCTCGACGGTGGCTCGGTGCCCCACGAC

[0069] TGGAGAAGCCCACAACGAGAAGCGAGCTGATAGTAGCTATGTGTGCAAACAAGGCTTC

[0070] ACTGACCGTGGGTG GGGCAACGGATGTGGATTT TT CGGGAAGGGAAGCATTGACACAT

[0071] F3 F2

[0072] GTGCAAAATTCTCCTGCACCAGTAAAGCGATTG GGAGAACAATCCAGCCAGAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of the kit. The visual kit contains a primer group and color development substances, wherein primers have sequences shown as SEQ ID NO.1-4, and the color development substances are calcein and manganese chloride. A using method of the kit comprises the following steps of: preparing an RT-LAMP system containing AMV reverse transcriptase, a 1 time reaction buffer solution, strand displacement DNA polymerase, a dNTP mixture, betaine, calcein, manganese chloride, MgSO4, a forward inner primer (FIP), a backward inner primer (BIP) group, an F3 primer, a B3 primer and RNA of a sample to be detected; performing thermostatic reaction on the reaction system at the temperature of between 61 and 65 DEG C, and inactivating; and judging a result under natural light or ultraviolet or natural light and ultraviolet, wherein if the reaction product is green under the natural light, the sample to be detected contains the Japanese B encephalitis virus; and if the reaction product represents obvious green fluorescence under the ultraviolet, the sample to be detected contains the Japanese B encephalitis virus.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an RT-LAMP visualization kit for detecting Japanese encephalitis virus and its application. Background technique [0002] Japanese encephalitis virus (JEV) belongs to the Flavivirus genus of the family Flaviviridae, and the Japanese encephalitis caused by it is a central nervous system zoonotic acute infectious disease. It is estimated that about 50,000 people in the world are infected with JEV every year, about 15,000 cases die, and the mortality rate is about 30%. The export of meat products is restricted. In 2008, the Ministry of Agriculture of my country classified swine Japanese encephalitis disease as a second-class animal disease. [0003] The disease was first reported in Japan in the 1870s, and Japanese encephalitis virus was first isolated in 1924. In China, Japanese encephalitis cases were confirmed by serology and virus isolation methods between 1938 and 1940, and the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 陈金顶刘薇张学涛赵明秋乔进平王波勾红潮
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products