Deleted human keratinocyte growth factor-I disulfide bond variant and its use
A technology for keratinocytes and growth factors, applied in fibroblast growth factors, growth factors/inducers, animal/human proteins, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Obtaining the cDNA sequence encoding human wild-type KGF-I
[0056] According to the amino acid and cDNA sequence (GI: 186738) of natural wild-type hKGF-I, and according to the codon preferred by Escherichia coli, the following base sequence of SeqID No: 3 (total 489bp) was designed, entrusted by Bao Biological (Dalian) Co., Ltd. ( TAKARA, Dalian) for whole gene synthesis, embedded in pUC18 vector and named pUC18-KGF.
[0057] TGCAATGACATGACTCCTGAACAAATGGCTACCAATGTCAACTGTTCCTCTCCGGAGCGCCACACCCGGAGTTACGACTACATGGAAGGTGGTGACATCCGTGTTCGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGTGGTAAAGTTAAAGGTACCCAGGAAATGAAAAACAACTACAACATCATGGAAATCCGTACCGTTGCTGTTGGTATCGTTGCTATCAAAGGTGTTGAATCTGAGTTCTACCTGGCTATGAACAAAGAAGGTAAACTGTACGCTAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCTTCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCTATCACC。
Embodiment 2
[0058] Example 2: Construction of Deletion Δ23hKGF-I Recombinant Plasmid and Engineering Strain
[0059] According to the amino acid sequence of Δ23hKGF-I (SeqIDNo: 1), primers P1 and P2 were designed and synthesized:
[0060] P1: 5'-gCATATgTACgACTACATggAAggTggTgAC-3' (SeqIDNo: 4)
[0061] P2: 5'-gggATCCTCAggTgATagCCATCgg-3' (SeqIDNo: 5)
[0062] P1 is the Δ23 forward primer, where g is the protective base, and CATATg is the NdeI restriction site;
[0063] P2 is the Δ23 reverse primer, where g is the protective base, and ggATCC is the BamHI restriction site.
[0064] Using pUC18-KGF plasmid as a template, primers P1 and P2 were used to amplify the Δ23hKGF-I gene fragment. The PCR reaction conditions were: 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min, a total of 30 cycles. The first cycle was denaturation at 94°C for 10 min, and the last cycle was extension at 72°C for 10 min. The results showed that a 420bp amplified fragment was obtained. After the PCR product was r...
Embodiment 3
[0065] Example 3: Construction of Mutant Δ23S79hKGF-I Recombinant Plasmid and Engineering Strain
[0066] According to the amino acid sequence of Δ23S79hKGF-I (SeqIDNo: 2), two pairs of primers were designed and synthesized:
[0067] P3: 5'-gCATATgTACgACTACATggAAggTggTgAC-3' (SeqIDNo: 4)
[0068] P4: 5'-gggATCCTCAggTgATagCCATCgg-3' (SeqIDNo: 5)
[0069] P5: 5'-gCTAAAAAAgAATCCAACgAAgACC-3' (SeqIDNo: 6)
[0070] P6: 5'-TTCgTTggATTCTTTTTTAGCgTA-3' (SeqIDNo: 7)
[0071] P3 is the forward primer, the same as P1;
[0072] P4 is a reverse primer, the same as P2;
[0073] P5 is a forward primer, used for amplification corresponding to the 102nd Ser point mutation in the natural sequence;
[0074] P6 is a reverse primer, which is used for amplification corresponding to the 102nd Ser point mutation in the natural sequence.
[0075] Using the pET-3C-Δ23 plasmid as a template, use primers P3 and P6 to amplify the cDNA fragment at the 5' end containing the mutation point, and use pri...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More