Anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum

A Plasmodium falciparum, monoclonal antibody technology, applied in the fields of parasitology and immunology

Inactive Publication Date: 2012-10-10
JILIN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no reports on the preparation of monoclonal antibodies against the DBL region of the Pf332 membrane protein of Plasmodium falciparum and the screening of monoclonal antibodies that can inhibit the parasites from invading red blood cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum
  • Anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum
  • Anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Construction of recombinant expression vectors pQE-DBL and pGEX-4T-1-DBL

[0030] In this embodiment, according to the nucleotide sequence of the Pf332-DBL region, the following PCR primers were synthesized:

[0031] The upstream primer is: 5′-GCGAATTCAGCAACATCAACAACAAGG-3′;

[0032] The downstream primer is: 5′- GCGCGGCCGCTTAGGCGTACTTCTTCTCGA -3′

[0033]Using the Plasmodium falciparum cDNA as a template, carry out PCR amplification with the above primers to obtain the Pf332-DBL gene fragment, the nucleotide sequence of which is shown in SEQ ID No.3, and connect it to the His tag fusion expression vector pQE-70 , the build gets

[0034] The recombinant expression vector pQE-DBL is used to express the recombinant protein DBL-His containing His tag.

[0035] Using the Plasmodium falciparum cDNA as a template, the above primers were used for PCR amplification to obtain the Pf332-DBL gene fragment, which was connected to the GST tag fusion expression vector pGEX-4T-1 to...

Embodiment 2

[0038] Expression and Purification of Recombinant Antigens DBL-His and DBL-GST

[0039] The recombinant expression vectors pQE-DBL and pGEX-4T-1-DBL in Example 1 were respectively transformed into M15 and BL21(DE3) host bacteria, and after induction and expression were performed respectively, DBL-His was purified by affinity chromatography. and DBL-GST recombinant antigen for SDS-PAGE analysis (such as figure 1 ). Use anti-His tag monoclonal antibody or anti-GST tag monoclonal antibody and anti-Pf332-DBL mouse polyclonal antibody as the primary antibody to carry out Western blotting identification on the recombinant protein, and there are specific bands at 28kDa and 52kDa respectively (such as figure 2 ). The amino acid sequence of DBL-His is shown in SEQ ID No.4, and the amino acid sequence of DBL-GST is shown in SEQ ID No.5.

Embodiment 3

[0041] Preparation of Monoclonal Antibody Against Pf332 Membrane Protein DBL Region of Plasmodium falciparum

[0042] (1) Animal immunity

[0043] The immunization program adopts the method of long-term high-dose. Take 5 female BALB / c mice aged 6-8 weeks, and mix the immune antigen DBL-His purified in Example 2 with an equal amount of Freund's complete adjuvant for the first immunization, and inject it intraperitoneally after the emulsification is complete. Rats were immunized with 50 μg of antigen. Afterwards, the rats were immunized every 3 weeks with the same dose, and the adjuvant was replaced by Freund's incomplete adjuvant. Blood was collected from the tail vein 10-14 days after each immunization, and the serum was separated to detect the specific antibody titer by indirect ELISA method (the purified detection antigen DBL-GST coated ELISA plate in Example 2) until the antibody titer meets the requirements of cell fusion (1:5×10 4 above). Three days before fusion, mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum. The anti-Pf 332-DBL sectional monoclonal antibody can be specifically bound with DBL sectional functional polypeptide of a Pf 332 membrane protein of the plasmodium falciparum, wherein the DBL sectional functional polypeptide of the Pf 332 membrane protein of the plasmodium falciparum has the amino acid sequence as shown in SEQ ID No.2. The anti-Pf 332-DBL sectional monoclonal antibody can be obtained through a method that splenocyte is fused with an Sp 2 / 0 cell byusing a DBL recombinant protein immunized mouse with an His label, and the DBL recombinant protein with a GST label is adopted for initially selecting, and the functional polypeptide is adopted for positive selecting. The anti-Pf 332-DBL sectional monoclonal antibody has a powerful function of inhibiting the invasion of polypide, and the function is stronger than that of an MP antibody which is purified from Mali human serum that is infected by the plasmodium falciparum; a monoclonal antibody incapable of being specifically bound with the functional polypeptide has relatively weak or no function of inhibiting the invasion of the polypide; and the DBL sectional functional polypeptide can be applied to the research and development of therapeutic polypeptide drugs for malaria and the development of preventive polypeptide vaccine.

Description

[0001] The application date is May 18, 2010, the application number is 201010174866.6, and the title of the invention is a divisional application of an invention patent application for an anti-Pf332-DBL region monoclonal antibody that can inhibit the invasion of Plasmodium falciparum. Technical field: [0002] The present invention relates to the fields of parasitology and immunology. More specifically, the present invention relates to an anti-Pf332-DBL region monoclonal antibody that can inhibit the invasion of Plasmodium falciparum and a functional polypeptide of the Pf332 membrane protein DBL region of Plasmodium falciparum Background technique: [0003] The emergence and spread of Plasmodium drug resistance has seriously exacerbated the global malaria epidemic. The annual death toll from malaria has risen from about 500,000 in the 1970s to about 1 million at present. The measures to prevent and control malaria with drugs are also facing serious difficulties and challen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/445C07K16/20A61K39/395A61P33/06
CPCY02A50/30
Inventor 姜宁陈启军杜承尹继刚陆慧君
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap