Anti-Pf 332-DBL sectional monoclonal antibody capable of inhibiting invasion of plasmodium falciparum
A Plasmodium falciparum, monoclonal antibody technology, applied in the fields of parasitology and immunology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Construction of recombinant expression vectors pQE-DBL and pGEX-4T-1-DBL
[0030] In this embodiment, according to the nucleotide sequence of the Pf332-DBL region, the following PCR primers were synthesized:
[0031] The upstream primer is: 5′-GCGAATTCAGCAACATCAACAACAAGG-3′;
[0032] The downstream primer is: 5′- GCGCGGCCGCTTAGGCGTACTTCTTCTCGA -3′
[0033]Using the Plasmodium falciparum cDNA as a template, carry out PCR amplification with the above primers to obtain the Pf332-DBL gene fragment, the nucleotide sequence of which is shown in SEQ ID No.3, and connect it to the His tag fusion expression vector pQE-70 , the build gets
[0034] The recombinant expression vector pQE-DBL is used to express the recombinant protein DBL-His containing His tag.
[0035] Using the Plasmodium falciparum cDNA as a template, the above primers were used for PCR amplification to obtain the Pf332-DBL gene fragment, which was connected to the GST tag fusion expression vector pGEX-4T-1 to...
Embodiment 2
[0038] Expression and Purification of Recombinant Antigens DBL-His and DBL-GST
[0039] The recombinant expression vectors pQE-DBL and pGEX-4T-1-DBL in Example 1 were respectively transformed into M15 and BL21(DE3) host bacteria, and after induction and expression were performed respectively, DBL-His was purified by affinity chromatography. and DBL-GST recombinant antigen for SDS-PAGE analysis (such as figure 1 ). Use anti-His tag monoclonal antibody or anti-GST tag monoclonal antibody and anti-Pf332-DBL mouse polyclonal antibody as the primary antibody to carry out Western blotting identification on the recombinant protein, and there are specific bands at 28kDa and 52kDa respectively (such as figure 2 ). The amino acid sequence of DBL-His is shown in SEQ ID No.4, and the amino acid sequence of DBL-GST is shown in SEQ ID No.5.
Embodiment 3
[0041] Preparation of Monoclonal Antibody Against Pf332 Membrane Protein DBL Region of Plasmodium falciparum
[0042] (1) Animal immunity
[0043] The immunization program adopts the method of long-term high-dose. Take 5 female BALB / c mice aged 6-8 weeks, and mix the immune antigen DBL-His purified in Example 2 with an equal amount of Freund's complete adjuvant for the first immunization, and inject it intraperitoneally after the emulsification is complete. Rats were immunized with 50 μg of antigen. Afterwards, the rats were immunized every 3 weeks with the same dose, and the adjuvant was replaced by Freund's incomplete adjuvant. Blood was collected from the tail vein 10-14 days after each immunization, and the serum was separated to detect the specific antibody titer by indirect ELISA method (the purified detection antigen DBL-GST coated ELISA plate in Example 2) until the antibody titer meets the requirements of cell fusion (1:5×10 4 above). Three days before fusion, mi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap