Method for high-sensitivity detection for t-DNA (transfer-deoxyribose nucleic acid) by aid of SERS (surface enhanced Raman spectroscopy) liquid chip

A sensitive detection and liquid-phase chip technology, which is applied in the field of SERS liquid-phase chips for highly sensitive detection of t-DNA, can solve the problems of dispersing the signal intensity of SERS probes, limiting the binding capacity of c-DNA, and reducing the hybridization efficiency of DNA strands, etc. Achieve the effect of improving detection sensitivity, improving capture efficiency, and increasing detection sensitivity

Inactive Publication Date: 2012-10-10
FUDAN UNIV
View PDF6 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The preparation method of the immobilized substrate of the membrane chip is simple, but there are the following disadvantages: (1) the hybridization reaction between the DNA strands is carried out in the solid phase, which greatly reduces the hybridization efficiency between the DNA strands; (2) the specific surface area of ​​the membrane chip Smaller, which greatly limits the binding capacity of c-DNA; (3) Since c-DNA is bound to the entire surface of the chip, the SERS probes are evenly distributed on the entire substrate surface (much larger than the laser spot area detected by SERS), thus dispersing The signal intensity of the SERS probe is reduced, and the detection sensitivity is reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-sensitivity detection for t-DNA (transfer-deoxyribose nucleic acid) by aid of SERS (surface enhanced Raman spectroscopy) liquid chip
  • Method for high-sensitivity detection for t-DNA (transfer-deoxyribose nucleic acid) by aid of SERS (surface enhanced Raman spectroscopy) liquid chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Capture DNA (c-DNA): 5’NH 2 (A 10 )TCTATAAACCTTATT (SEQ.ID.NO.1)

[0030] Target DNA (t-DNA): AGATATTTGGAATAACATGACCTGGATGCA (SEQ.ID.NO.2)

[0031] Probe DNA (p-DNA): GTACTGGACCTACGT(A 10 )NH 2 3' (SEQ. ID. NO. 3)

[0032] 1. Preparation of SERS probes

[0033] The preparation of SERS probes is completed in the following three steps:

[0034] The first step is to modify the surface of the SERS tag to amino groups:

[0035] Disperse 10 mg of the SERS tag embedded in 4-aminothiophenol (4-ABT) reported in the patent (CN102206357A) in a mixed solution of 9 g of water and 32 g of ethanol, and then add 1 g of ammonia water and 0.1 g of 3-ammonia Propyltriethoxysilane (APTES) was ultrasonically emulsified for 1 h with an ultrasonic power of 600 W to obtain SERS-labeled microspheres with surface-modified amino groups.

[0036] The second step is to modify the amino groups on the surface of the SERS label to carboxyl groups:

[0037] Add 20 mg of SERS tag with surface-mod...

Embodiment 2

[0047] Capture DNA (c-DNA): 5'NH 2 (A 10 ) AACCGAAAGTCAATA (SEQ.ID.NO.4)

[0048] Target DNA (t-DNA): TTGGCTTTCAGTTATATGGATGATGTGGTA (SEQ.ID.NO.5)

[0049] Probe DNA (p-DNA): TACCTACTACACCAT (A 10 )NH 2 3' (SEQ.ID.NO.6)

[0050] 1. The preparation of the SERS probe is the same as that described in Example 1-1. The difference is that the Raman marker molecule embedded in the SERS tag is 4-chlorothiophenol (4-CBT).

[0051] 2. The preparation of the magnetic capture substrate is the same as described in Examples 1-2.

[0052] 3. The process of detecting t-DNA by using the SERS liquid phase chip method is the same as that described in Examples 1-3.

[0053] A detection limit of 10 was obtained -12 M.

Embodiment 3

[0055] Capture DNA (c-DNA): 5’NH 2 (A 10 )AATCTCAACGTACCT (SEQ.ID.NO.7)

[0056] Target DNA (t-DNA): TTAGAGTTGCATGGATTAACTCCTCTTTCT (SEQ.ID.NO.8)

[0057] Probe DNA (p-DNA): AATTGAGGAGAAAGA (A 10 )NH 2 3' (SEQ.ID.NO.9)

[0058] 1. The preparation of the SERS probe is the same as that described in Example 1-1. The difference is that the Raman marker molecule embedded in the SERS tag is 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB).

[0059] 2. The preparation of the magnetic capture substrate is the same as described in Examples 1-2.

[0060] 3. The process of detecting DNA by using the SERS liquid-phase chip method is the same as that described in Examples 1-3.

[0061] A detection limit of 10 was obtained -11 M.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological molecule detection, and particularly discloses a method for high-sensitivity detection for t-DNA (transfer-deoxyribose nucleic acid) by the aid of an SERS (surface enhanced Raman spectroscopy) liquid chip. In the method, surface enhanced Raman spectroscopy (SERS) is used for coding, and the SERS liquid chip with magnetic composite nanoparticles as a capturing substrate is used for detecting the t-DNA in a high-sensitivity manner. The method includes chemically bonding the nanoparticles (SERS labels) comprising SERS codes with p-DNA (phosphorous-deoxyribose nucleic acid) of a probe to prepare a high-sensitivity SERS probe at first; capturing the c-DNA (complementary-deoxyribose nucleic acid) by the magnetic composite nanoparticles with surfaces richly containing carboxyl in a chemical bonding manner to prepare the magnetic capturing substrate; and constructing the SERS liquid chip by the SERS probe and the magnetic capturing substrate to detect the t-DNA. The method is simple, speedy and sensitive in operation, can be used for high through-put, quantitative and multi-element detection for DNA (deoxyribose nucleic acid), can be widely used in fields such as food safety monitoring, medical diagnosis and forensic examination, and has an important application prospect and a development value.

Description

technical field [0001] The invention belongs to the technical field of biomolecular detection, and in particular relates to a SERS liquid phase chip method for highly sensitive detection of t-DNA. Background technique [0002] The detection of DNA molecules has important application value in the fields of gene therapy, food safety monitoring, medical diagnosis, forensic analysis, and cultural relic identification. Currently, the most widely used detection method is fluorescence spectroscopy. However, the fluorescence is easily quenched, resulting in extremely poor reproducibility of the fluorescence signal. In addition, the fluorescence emission spectrum is relatively wide (the half-maximum spectral width of organic fluorescent dyes is 50-100 nm, and that of quantum dots is 25-40 nm), which leads to easy overlapping of emission spectra, so the resolution of fluorescence spectra is very low ( Sun, L.; Yu, C. X.; Irudayaraj, J. Anal. Chem. 2007, 79, 3981-3988). Compared wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N21/65
Inventor汪长春李菊梅
OwnerFUDAN UNIV