Detection kit for potassium ion concentration
A potassium ion concentration and kit technology, applied in the field of biomedicine, can solve problems such as complex operation and large errors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] In this embodiment, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 5.84mmol / L, urine sample 2 is 22.25mmol / L, and urine sample 3 is 38.17 mmol / L. The DNA capable of forming a G-quadruplex used in this example is TTAGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula
[0054]
[0055] 1) Prepare standard solution samples
[0056] Dissolve a certain amount of DNA sample in Tris-HCl (Tris-Na) buffer (pH8.0) containing 20mmol / L NaCl to prepare a DNA stock solution with a concentration of 100μmol / L for later use.
[0057] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 9.1 ml of Tris-Na buffer, and then add 600 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1mL.
[0058] Take 7 samples among them, add a certain amount of Tris-N...
Embodiment 2
[0064] In this example, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 9.18mmol / L, urine sample 2 is 32.43mmol / L, and urine sample 3 is 49.57 mmol / L. The DNA capable of forming a G-quadruplex used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula
[0065]
[0066] 1) Prepare standard solution samples
[0067] A certain amount of DNA sample was dissolved in Tris-HCl (Tris-Na) buffer (pH6.2) containing 40mmol / L NaCl to prepare a DNA stock solution with a concentration of 500μmol / L for later use.
[0068] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 9.14 ml Tris-Na buffer, and then add 360 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.98mL.
[0069] Take 7 samples among them, add a certain amount of Tris-...
Embodiment 3
[0075] In this embodiment, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 9.82mmol / L, urine sample 2 is 20.35mmol / L, and urine sample 3 is 78.26 mmol / L. The DNA capable of forming a G-quadruplex used in this example is TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula
[0076]
[0077] 1) Prepare standard solution samples
[0078] A certain amount of DNA sample was dissolved in Tris-HCl (Tris-Na) buffer (pH 7.5) containing 100 mmol / L NaCl to prepare a DNA stock solution with a concentration of 500 μmol / L for later use.
[0079] Take 0.4 mL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 4.2 mL of Tris-Na buffer, then add 0.4 mL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.5mL.
[0080] Take 7 samples among them, add a certain am...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 