Detection kit for potassium ion concentration

A potassium ion concentration and kit technology, applied in the field of biomedicine, can solve problems such as complex operation and large errors

Active Publication Date: 2013-01-09
INST OF CHEM CHINESE ACAD OF SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] (5) Atomic spectrophotometry can also be used to detect potassium and sodium ions in serum,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for potassium ion concentration
  • Detection kit for potassium ion concentration
  • Detection kit for potassium ion concentration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] In this embodiment, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 5.84mmol / L, urine sample 2 is 22.25mmol / L, and urine sample 3 is 38.17 mmol / L. The DNA capable of forming a G-quadruplex used in this example is TTAGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula

[0054]

[0055] 1) Prepare standard solution samples

[0056] Dissolve a certain amount of DNA sample in Tris-HCl (Tris-Na) buffer (pH8.0) containing 20mmol / L NaCl to prepare a DNA stock solution with a concentration of 100μmol / L for later use.

[0057] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 9.1 ml of Tris-Na buffer, and then add 600 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1mL.

[0058] Take 7 samples among them, add a certain amount of Tris-N...

Embodiment 2

[0064] In this example, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 9.18mmol / L, urine sample 2 is 32.43mmol / L, and urine sample 3 is 49.57 mmol / L. The DNA capable of forming a G-quadruplex used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula

[0065]

[0066] 1) Prepare standard solution samples

[0067] A certain amount of DNA sample was dissolved in Tris-HCl (Tris-Na) buffer (pH6.2) containing 40mmol / L NaCl to prepare a DNA stock solution with a concentration of 500μmol / L for later use.

[0068] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 9.14 ml Tris-Na buffer, and then add 360 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.98mL.

[0069] Take 7 samples among them, add a certain amount of Tris-...

Embodiment 3

[0075] In this embodiment, the potassium ion concentration of three urine samples is verified. The actual potassium ion concentration of each urine sample is as follows: urine sample 1 is 9.82mmol / L, urine sample 2 is 20.35mmol / L, and urine sample 3 is 78.26 mmol / L. The DNA capable of forming a G-quadruplex used in this example is TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula

[0076]

[0077] 1) Prepare standard solution samples

[0078] A certain amount of DNA sample was dissolved in Tris-HCl (Tris-Na) buffer (pH 7.5) containing 100 mmol / L NaCl to prepare a DNA stock solution with a concentration of 500 μmol / L for later use.

[0079] Take 0.4 mL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 4.2 mL of Tris-Na buffer, then add 0.4 mL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.5mL.

[0080] Take 7 samples among them, add a certain am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a detection kit for potassium ion concentration. The method comprises the steps of: adding a sample to be detected into a mixed solution of DNA with a G-four chain body and cyanine dye by means of the characteristic that the G-four chain body DNA structural transformation can be formed by regulating potassium ion and the characteristic that cyanine dye supermolecular aggregate identifies the G-four chain body structural transformation; and semi-quantitatively judging the potassium ion concentration range in the sample according to color of the solution. Visual detection of potassium ion concentration can be realized by using the kit which can be realized, and the detection kit can be developed as a detection strip. The kit is simple in components, simple in reaction process, low in detection cost and convenient for being popularized and applied in the industry, and special instruments or extra instruments are not needed.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a potassium ion concentration detection kit. Background technique [0002] Potassium in the human body is the main cation for maintaining the physiological activities of cells. It is necessary to maintain the normal osmotic pressure and acid-base balance of the body, participate in the metabolism of sugar and protein, and ensure the normal function of neuromuscular. Its content is an important indicator of human physiological activities. The levels of potassium ions in urine and serum can be clinically used to diagnose some kidney and heart diseases. [0003] Under normal circumstances, the potassium ion concentration of the human body has a reasonable reference range, such as in serum: 3.5-5.5mmol / L; in urine: 25-125mmol / 24h. When the potassium ion is higher than the reference value, hyperkalemia is manifested. The main reasons are: acute renal failure, severe hemolysis o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N21/78G01N33/52
CPCC09B23/06C09B23/0008G01N31/22G01N33/84
Inventor 唐亚林孙红霞杨千帆尚倩姜薇盖伟向俊锋
Owner INST OF CHEM CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap