Supercharge Your Innovation With Domain-Expert AI Agents!

LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas

A detection kit and technology for chicken histiomonas, applied in the biological field, can solve the problems of non-specific occurrence, detection time of at least 3 hours, time-consuming and laborious histopathological examination, cumbersome isolation and cultivation of parasites, etc., and saving instruments. Cost, high accuracy, fast cost effect

Active Publication Date: 2013-12-11
YANGZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, the reported laboratory diagnostic methods for histomonas include: microscopic examination, histopathological examination, parasite isolation and culture, polymerase chain reaction (Polymerase Chain Reaction, PCR), enzyme-linked immunosorbent assay (Enzyme-Linked Immunosorbent Assay, ELISA), etc., several methods can directly detect the histotrichomoniasis pathogen in the disease material, but the morphology of the pathogen is similar to Tetratrichomonas and Blastocystis in microscopic examination, which is easily confused, and histopathological examination is time-consuming It is laborious, and the isolation and culture of worms is very cumbersome and time-consuming. PCR and ELISA must be equipped with special instruments. The operation is relatively cumbersome, and non-specificity often occurs. The detection time needs at least 3 hours.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas
  • LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas
  • LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Make the loop-mediated isothermal amplification detection kit for Histomonas turkey according to the following formula:

[0028] (1) Reaction solution A:

[0029] Contains 10× isothermal reaction buffer, Bst DNA polymerase 8000U / mL, 10mM dNTP, 25mM MgCl 2 , 200 μM inner primer, 200 μM inner primer 2, 100 μM outer primer 1, 100 μM outer primer 2, 5M betaine and deionized water, wherein:

[0030] 10× isothermal reaction buffer containing 200 mM Tris-Hydroxymethylaminomethane hydrochloride (pH 8.8), 100 mM Potassium Chloride, 100 mM Ammonium Sulfate, 20 mM Magnesium Sulfate and 1% (m / V) Triton X-100 ( pH8.8, 25°C);

[0031] Internal primer 1 is: GAGCCCATGAACTATTGATTTCTCTAGTTCCTACCTTAAACTATGCC

[0032] Internal primer 2 is: CTACGACCGCAAGGCTGAAATTAAGCCACAAGCTCCAC

[0033] Outer primer 1 is: GTATCCAACCGGATCAGAG

[0034] The outer primer 2 is: AAGTTTCCCCCGTGTTGAT

[0035] (2) Reaction solution B: 1000× fluorescent dye SYBR Green I.

[0036] LAMP reaction solution A is 2...

Embodiment 2

[0038] Example 2: Detection of Histomonas turkey using LAMP Detection Kit for Histomonas turkey

[0039] Preparation of the treatment solution for the sample to be tested: Take the sample taken from chicken liver as an example, the diseased chicken liver was used as a positive sample, the normal chicken liver was used as a negative sample, and deionized water without samples was set up as a blank control.

[0040] A. Take 0.5g of liver tissue, add 1mL of cell lysis buffer (100mM pH8.0Tris, 500mM pH8.0EDTA, 20mM NaCL, 10%SDS), homogenize in a glass homogenizer until cloudy, and place the turbid solution at 1.5 mL centrifuge tube;

[0041] B. Add 20 μL of proteinase K (20mg / mL) and mix well, then bathe in a constant temperature water bath at 65°C for 30 minutes;

[0042] C. Centrifuge at 12000×g for 5min, take the supernatant into another centrifuge tube;

[0043] D. Add the same amount of phenol: chloroform: isoamyl alcohol (25:24:1), shake and mix well, centrifuge at 12000×g...

Embodiment 3

[0053] Example 3: Sensitivity test of the LAMP detection method for histomonas turkey

[0054] Take the plasmid DNA containing the specific gene of Histomonas turkey, and dilute it by 10 times as the template for the LAMP detection test, so that each μL of the dilution contains 10 copies of the template gene. 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 ,10,1;

[0055] Add 1 μL of the above genome diluent to the PCR reaction tube containing 24 μL of reaction solution A, and set a blank control without plasmid DNA at the same time, mix and centrifuge, drop 1 μL of reaction solution B in the middle of the inner side of the PCR tube cap, and cover tightly Place the tube cap in a constant temperature water bath at 60-65°C for 60 minutes;

[0056] Invert the PCR tube several times to fully mix the reaction mixture with reaction solution B. Observe the color of the reaction solution with the naked eye. The result shows that the reaction tube with plasmid DNA turns green, and t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit for quickly detecting turkey histomonas melegridis by an LAMP (loop-mediated isothermal amplification) technology. The kit comprises reaction liquid A and reaction liquid B (1000* fluorochrome SYBRGreen I), wherein the reaction liquid A contains 10* isothermal reaction buffer solution, 8000U / mL of Bst DNA polymerase, 10mM of dNTP (diethyl-nitrophenyl thiophosphate), 25mM of MgCl2, 200muM of inner primer, 200muM of inner primer 2, 100muM of outer primer 1, 100muM of outer primer 2, 5M of glycine betaine and deionized water,. The turkey histomonas melegridis can be detected through the DNA extraction of a turkey liver tissue sample, the loop-mediated isothermal amplification of the turkey histomonas melegridis, and the color developing detection of an amplification product. The defect that the prior art is long in time, large in workload, complex to operate and the like can be overcome. The kit is high in specificity, high in sensitivity, quick in speed, low in cost, simpler in operation method, and suitable for the quick detection in the field.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a kit for rapidly detecting histomoniasis in turkeys by using a loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology, and to a kit for rapidly detecting turkeys using the kit Methods of organizing trichomoniasis. Background technique [0002] Histomoniasis, also known as "blackhead disease" and "cecal hepatitis", is a protozoan disease caused by Histomonas meleagridis parasitizing in poultry. It is characterized by liver necrosis, enlarged cecum and sulfur-like feces. main features. At present, this disease is very prevalent in many countries and regions such as China, Europe and the United States. Due to the serious pollution of poultry houses in some farms, it often leads to outbreaks of the disease, and the mortality rate reaches 20-30%. The economic loss is very serious. [0003] Early detection and early treatment are very important f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 许金俊曲昌宝陶建平刘聪刘丹丹曹李琴侯照峰宿世杰郭平李聪张祖航
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More