JAK2 gene mutation detection method and kit thereof
A technology for detection kits and detection methods, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problem of small detection range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] The present invention will be further described below by taking a sample to be tested of a typical patient with polycythemia vera as an example.
[0030] (a) extract the DNA of the sample to be tested;
[0031] (b) using JAK2 gene exon No. 12 PCR amplification primers and JAK2 gene exon No. 14 PCR amplification primers to perform PCR amplification on the DNA of the sample to be tested in step (a) from the positive and negative directions;
[0032] (c) using the JAK2 gene exon 12 sequencing reaction primer and the JAK2 gene exon 14 sequencing reaction primer to sequence the DNA amplified in step (b) from both forward and reverse directions;
[0033] (d) Compare the sequencing results in step (c) with the standard JAK2 gene exon 12 and exon 14 from the positive and negative directions, and after sequence analysis: it is found that the exon 12 of the JAK2 gene (gene Accession number: NM_004972) ATGTTTCACAAAAATCAGAAATGAAGATTTGATA was inserted at the 2133th bp, a total of 3...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
