RT-PCR primers and kit for detecting high-pathopoiesia porcine reproductive andrespiratory syndrome and classic porcine reproductive andrespiratory syndrome

Abstract

The invention discloses a pair of RT-PCR ( reverse transcription-polymerase chain reaction) primers and a kit for detecting high-pathopoiesia pig blue ear disease and classic pig blue ear disease. The upstream primer nucleotide sequence of the primers is GGCGACAATGTCCCTAAC, the downstream primer nucleotide sequence of the primers is GATGGCTTGAGCTGAGTAT, and the kit contains the primers. The primers and the kit for detecting high-pathopoiesia porcine reproductive andrespiratory syndrome and classic porcine reproductive andrespiratory syndrome have the advantages of high sensibility, strong specificity, rapidness and convenience, low detecting cost and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a pair of RT-PCR primers and a kit for detecting highly pathogenic porcine blue-ear disease and classic porcine blue-ear disease. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS) is an acute infectious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV). The main clinical features are abortion, stillbirth, mummified fetus, and weak fetus. Difficulty breathing, etc. During the course of the disease, the skin of both ears will appear cyanotic and purple, so it is also called "blue ear disease". The disease was first reported in my country in 1996. [0003] In 2006, pig farms (households) broke out in pig farms (households) in 2006. The pigs were characterized by "high fever", "high morbidity" and "high mortality". a greater economic loss. Research by Tian Kegong from the Chinese Center for Animal Disease Prevent...

AI Technical Summary

Problems solved by technology

Using the above primers can only detect whether it is infected with the highly pathogenic PRRS virus, but cannot determine whether it is infected with the classic PRRS virus, or the two are co-infected

Chinese Patent (Application No.) 200910077704.8 discloses a dual real-time fluorescent RT-PCR identification method for PRRSV classic strains and highly pathogenic variant strains. The primer pair used in this method is: the upstream primer PRRSV-F2 with the sequence CGCACCAGATGGRACCTACTT and the sequence A primer pair consisting of the downstream primer PRRSV-R3 of ACGGTGTTCAGTGAGGGCTTT, and a primer pair consisting of the reverse complementary sequence of the upstream primer AAGTAGGTYCCATCTGGTGCG and the reverse complementary sequence of the downstream primer AAAGCCCTCACTGAACACCGT, the primer pair can identify whether the sample is classic PRRSV after one reaction strain infection, or PRRSV highly pathogenic variant infection, or both co-infection, but the real-time fluorescent RT-PCR method requires expensive equipment and high cost

Images