Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for producing color-changeable light-induced fluorescent spectacular fish

A technology for inducing fluorescence and ornamental fish, which can be applied to other methods of inserting foreign genetic materials, fish farming, climate change adaptation, etc. , to improve the fun, increase the interaction of the mermaid, and expand the pattern.

Active Publication Date: 2014-01-29
马明 +1
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

First of all, the existing fluorescent ornamental fish construction technology realizes the tissue-specific expression of fluorescent protein, that is, the fluorescence appears only in specific tissues of the fish, and the fluorescent fish thus constructed lacks a certain degree of ornamental value from the visual point of view.
Secondly, the expression of monochromatic fluorescence is achieved, and the color cannot be changed under external stimuli. The fluorescent ornamental fish obtained from this lacks certain interactivity or interest.
In addition, some fish have more pigmentation on their body surface, which leads to a decrease in the transparency of the fish surface, which not only shields the excitation of the fluorophore by the excitation light, resulting in low luminescence efficiency of the fluorophore, but also blocks the emission of the fluorophore. Light reaches the outside of the body, further reducing ornamental
In order to save this shortcoming to a certain extent, the above-mentioned patent has to use a strong promoter to drive the expression of the fluorescent group, but the price is that the phototoxicity of the fluorescent group affects the health of the fish and greatly shortens the lifespan of the fish
[0005] In addition, none of the fluorescent fish obtained in the prior art has been sterilized. Once such transgenic fish species enter the natural environment, they may cause unpredictable potential harm to natural species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing color-changeable light-induced fluorescent spectacular fish
  • Method for producing color-changeable light-induced fluorescent spectacular fish
  • Method for producing color-changeable light-induced fluorescent spectacular fish

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1 Construction of color-changing light-induced fluorescent ornamental fish

[0066] Step 1: Construction of Ubiquitin Promoter-Kaede-mini Tol2 Vector

[0067] (1) Amplification and acquisition of target fragments

[0068] PCR amplification of the target fragment: Use the following primers to PCR out the target fragment Kaede (52°C, 30 cycles):

[0069]Kaede-F-SpeI: GGACTAGT ATGAGTCTGATTAAAC;

[0070] Kaede-R-EagI:ATCGGCCGTTACTTGACGTTGTCC.

[0071] The formula is shown in Table 1.

[0072] Table 1

[0073] components

Dosage

ddH2O

20 μL

2×PCR Mix (Biomed)

25 μL

PCR template

1μL

[0074] Kaede-F-SpeI

2μL

Kaede-R-EagI

2μL

total

50μL

[0075] PCR programming:

[0076] Step 1: 95°C for 1min;

[0077] Step 2: 94°C for 30s;

[0078] Step 3: 52°C for 30s;

[0079] Step 4: 1min at 72°C;

[0080] The fifth step: return to the second step, and cycle 30 times;

[008...

Embodiment 2

[0144] Example 2 Using fish species with more pigmentation on the body surface as materials to construct color-changing light-induced fluorescent ornamental fish

[0145] In this embodiment, the knockout of the zebrafish golden gene will be taken as an example for illustration.

[0146] Step 1: Construct the gRNA vector of the target sequence

[0147] Firstly, the genome sequence of the golden gene of zebrafish was found on the website of NCBI (National Center for Biotechnology Information). Find the exon region and lock the target sequence as GTGCAGGAGAGGAAAGATGG.

[0148] Then, to construct the target sequence gRNA, synthesize the following primers:

[0149] gRNA-F: CACCGTGCAGGAGAGGAAAGATGG

[0150]gRNA-R: ATACCCATCTTTTCCTCTCCTGCAC

[0151] Mix equal volumes of primers gRNA-F and gRNA-R with a final concentration of 10 nM (25 μL each, 50 μL total volume). On a PCR machine, perform annealing. The procedure is as follows: 98°C for 5 minutes, then naturally cool to room t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing spectacular fish capable of expressing color-changeable light-induced fluorescent light on a whole body and the color-changeable light-induced fluorescent spectacular fish obtained by the method through utilizing a promoter capable of universally starting expression on the whole body to drive the expression of color-changeable light-induced fluorescent light, and further provides a method for converting fishes with many body surface pigments to the spectacular fish capable of expressing the color-changeable light-induced fluorescent light on the whole body by gene modification and a product obtained by the method. Meanwhile, the spectacular fish is sterilized in order to guarantee the bio-security. The invention further provides a method for producing fancy breeds capable of emitting the color-changeable light-induced fluorescent light on the whole body aiming at other aquatic organisms including shrimps and jellyfishes. Therefore, an arousing wavelength is manually changed so that the fish can be changed to the other colors from one color within several seconds to generate an interesting spectacular effect, and furthermore, a pattern of a traditional spectacular fish market is expanded.

Description

technical field [0001] The invention relates to a method for producing fluorescent ornamental fish, in particular to a method for producing fluorescent ornamental fish induced by variable color light. Background technique [0002] Ornamental fish is a fish industry with a global market, and fluorescent fish has greatly changed the ornamental fish market because it can obtain eye-catching colors different from traditional fish, and has a unique decorative effect especially in low light conditions pattern. At present, the use of transgenic technology can obtain fish with specific traits in a short period of time, without the need to slowly change the characteristics of fish through traditional hybridization technology. The use of transgenic technology to obtain fluorescent ornamental fish has achieved great commercial value. [0003] In the prior art, there are many techniques for introducing exogenous genes into fish, including microinjection, virus-mediated gene integratio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/89A01K67/027A01K61/00
CPCY02A40/81
Inventor 马明李冰峰唐力史文天
Owner 马明
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More