Method for producing color-changeable light-induced fluorescent spectacular fish
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for inducing fluorescence and ornamental fish, which can be applied to other methods of inserting foreign genetic materials, fish farming, climate change adaptation, etc. , to improve the fun, increase the interaction of the mermaid, and expand the pattern.
Active Publication Date: 2014-01-29
马明 +1
View PDF11 Cites 8 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
First of all, the existing fluorescent ornamental fish construction technology realizes the tissue-specific expression of fluorescent protein, that is, the fluorescence appears only in specific tissues of the fish, and the fluorescent fish thus constructed lacks a certain degree of ornamental value from the visual point of view.
Secondly, the expression of monochromatic fluorescence is achieved, and the color cannot be changed under external stimuli. The fluorescent ornamental fish obtained from this lacks certain interactivity or interest.
In addition, some fish have more pigmentation on their body surface, which leads to a decrease in the transparency of the fish surface, which not only shields the excitation of the fluorophore by the excitation light, resulting in low luminescence efficiency of the fluorophore, but also blocks the emission of the fluorophore. Light reaches the outside of the body, further reducing ornamental
In order to save this shortcoming to a certain extent, the above-mentioned patent has to use a strong promoter to drive the expression of the fluorescent group, but the price is that the phototoxicity of the fluorescent group affects the health of the fish and greatly shortens the lifespan of the fish
[0005] In addition, none of the fluorescent fish obtained in the prior art has been sterilized. Once such transgenic fish species enter the natural environment, they may cause unpredictable potential harm to natural species
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0065] Embodiment 1 Construction of color-changing light-induced fluorescent ornamental fish
[0066] Step 1: Construction of Ubiquitin Promoter-Kaede-mini Tol2 Vector
[0067] (1) Amplification and acquisition of target fragments
[0068] PCR amplification of the target fragment: Use the following primers to PCR out the target fragment Kaede (52°C, 30 cycles):
[0069]Kaede-F-SpeI: GGACTAGT ATGAGTCTGATTAAAC;
[0070] Kaede-R-EagI:ATCGGCCGTTACTTGACGTTGTCC.
[0071] The formula is shown in Table 1.
[0072] Table 1
[0073] components
Dosage
ddH2O
20 μL
2×PCR Mix (Biomed)
25 μL
PCR template
1μL
[0074] Kaede-F-SpeI
2μL
Kaede-R-EagI
2μL
total
50μL
[0075] PCR programming:
[0076] Step 1: 95°C for 1min;
[0077] Step 2: 94°C for 30s;
[0078] Step 3: 52°C for 30s;
[0079] Step 4: 1min at 72°C;
[0080] The fifth step: return to the second step, and cycle 30 times;
[008...
Embodiment 2
[0144] Example 2 Using fish species with more pigmentation on the body surface as materials to construct color-changing light-induced fluorescent ornamental fish
[0145] In this embodiment, the knockout of the zebrafish golden gene will be taken as an example for illustration.
[0146] Step 1: Construct the gRNA vector of the target sequence
[0147] Firstly, the genome sequence of the golden gene of zebrafish was found on the website of NCBI (National Center for Biotechnology Information). Find the exon region and lock the target sequence as GTGCAGGAGAGGAAAGATGG.
[0148] Then, to construct the target sequence gRNA, synthesize the following primers:
[0149] gRNA-F: CACCGTGCAGGAGAGGAAAGATGG
[0150]gRNA-R: ATACCCATCTTTTCCTCTCCTGCAC
[0151] Mix equal volumes of primers gRNA-F and gRNA-R with a final concentration of 10 nM (25 μL each, 50 μL total volume). On a PCR machine, perform annealing. The procedure is as follows: 98°C for 5 minutes, then naturally cool to room t...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention provides a method for producing spectacular fish capable of expressing color-changeable light-induced fluorescent light on a whole body and the color-changeable light-induced fluorescent spectacular fish obtained by the method through utilizing a promoter capable of universally starting expression on the whole body to drive the expression of color-changeable light-induced fluorescent light, and further provides a method for converting fishes with many body surface pigments to the spectacular fish capable of expressing the color-changeable light-induced fluorescent light on the whole body by gene modification and a product obtained by the method. Meanwhile, the spectacular fish is sterilized in order to guarantee the bio-security. The invention further provides a method for producing fancy breeds capable of emitting the color-changeable light-induced fluorescent light on the whole body aiming at other aquatic organisms including shrimps and jellyfishes. Therefore, an arousing wavelength is manually changed so that the fish can be changed to the other colors from one color within several seconds to generate an interesting spectacular effect, and furthermore, a pattern of a traditional spectacular fish market is expanded.
Description
technical field [0001] The invention relates to a method for producing fluorescent ornamental fish, in particular to a method for producing fluorescent ornamental fish induced by variable color light. Background technique [0002] Ornamental fish is a fish industry with a global market, and fluorescent fish has greatly changed the ornamental fish market because it can obtain eye-catching colors different from traditional fish, and has a unique decorative effect especially in low light conditions pattern. At present, the use of transgenic technology can obtain fish with specific traits in a short period of time, without the need to slowly change the characteristics of fish through traditional hybridization technology. The use of transgenic technology to obtain fluorescent ornamental fish has achieved great commercial value. [0003] In the prior art, there are many techniques for introducing exogenous genes into fish, including microinjection, virus-mediated gene integratio...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more