Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit and method for detecting mycoplasma pollution in CHO cultured cells

A technology for culturing cells and mycoplasma, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and the determination/inspection of microorganisms, which can solve the problems of wasting reagents, cumbersome, and increasing the complexity of detection

Inactive Publication Date: 2014-03-12
NCPC NEW DRUG RES & DEV
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In this way, the positive control must be set separately in the detection, which not only wastes reagents, but also makes the PCR process and electrophoresis detection process more cumbersome.
At the same time, the genomic DNA of mycoplasma must be prepared separately, which increases the complexity of the detection; the most important problem is that the detection system and the positive control system are in different PCR systems, even if the positive control is normal, there may be misjudgments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for detecting mycoplasma pollution in CHO cultured cells
  • Kit and method for detecting mycoplasma pollution in CHO cultured cells
  • Kit and method for detecting mycoplasma pollution in CHO cultured cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1) Primer pair A and primer pair B

[0048] where primer pair A

[0049] Upstream primer GF: 5'- CAAAGGCACAGTCAAGGCTGA -3';

[0050] Downstream primer GR: 5'- TGGTGAAGACGCCAGTAGATT -3'.

[0051] Primer pair B

[0052] Upstream primer MF: 5'- ACACCATGGGAGCTGGTAAT -3';

[0053] Downstream primer MR: 5'- GTTCATCGACTTTCAGACCCAAGGCAT -3'.

[0054] The base sequences of primer pair A and primer pair B are references: Eldering JA, Felten C, Veilleux CA, Potts BJ. Development of a PCR method for mycoplasma testing of Chinese hamster ovary cell cultures used in the manufacture of recombinant therapeutic proteins, Biologicals , 2004, 32(4):183-193.

[0055] Primer pair B is a primer pair for specifically amplifying the conserved region of mycoplasma 16s rRNA, which can cover a variety of mycoplasma in one detection, and can cover the common types of mycoplasma infection in CHO cultured cells. The types of mycoplasma that this kit can detect include M. fermentans, M. hyorh...

Embodiment 2

[0060] 1) In order to make the thickness of the corresponding amplification bands of the positive control in the detection appropriate, and the detection of mycoplasma contamination bands will not cause corresponding amplification bands due to insufficient primer concentration, adjust the PCR amplification reaction system For the concentration ratio of primer pair A and primer pair B, three combinations are set, see attached figure 1 , respectively ①②③.

[0061] 2) Extract the DNA of CHO cultured cells confirmed to be contaminated by mycoplasma and the DNA of CHO cultured cells determined not to be contaminated by mycoplasma. 5 centrifuge at 6,000 rpm for 5 minutes; fully suspend the precipitate with PBS buffer, and centrifuge at 6,000 rpm for 5 minutes; discard the supernatant, add 50 μL TE buffer to fully suspend the precipitate, and bathe in boiling water for 5 minutes; centrifuge at 13,000 rpm for 10 minutes, and take 4 μL of each supernatant and add it to the PCR system ...

Embodiment 3

[0067] Extract the DNA of 14 groups of different culture batches of CHO cells to be tested in the logarithmic growth phase. For the method, see step 2 of Example 2), add 4 μL of the extracted DNA reaction template to the PCR reaction amplification system described in Example 2 In the process, add the nucleic acid-free water to another PCR reaction amplification system , as a negative control. Perform PCR amplification. For the reaction conditions of the amplification reaction, see Step 3 of Example 2), and then perform agarose gel electrophoresis.

[0068] The test results are attached image 3 . Swimming lane 1 is a negative control, and no amplification product appears; swimming lanes 2-15 are the tested samples, corresponding to the 1st-14th batch of samples tested in turn. It can be seen from the figure that the 150bp primer pair A has corresponding amplification products, which shows that the PCR system is working normally, and the PCR system is not polluted, and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit and a method for detecting mycoplasma pollution in CHO cultured cells, and belongs to the field of biological technology detection. The kit comprises a primer pair of the DNA sequence of a specific amplified CHO cell glyceraldehyde-3-phosphatedehydrogenase and a primer pair of the DNA sequence of a specific amplified mycoplasma 16srRNA conserved domain, and the two above primer pairs are placed in a same PCR system. According to the kit, when mycoplasma pollution is detected by employing the PCR technology, the determination of reliability of a detection result can be finished at the same time. The kit and the method help to substantially improve the reliability of the detection result on mycoplasma pollution in CHO cultured cells, the operation is simple, the detection period is short, and the sample detection operationality is good.

Description

technical field [0001] The invention relates to a kit for detecting mycoplasma in the field of biotechnology detection and a detection method thereof, in particular to a kit for rapidly and accurately identifying mycoplasma contamination in CHO cultured cells by using PCR technology and a detection method thereof. Background technique [0002] Since Robinson LB et al first reported mycoplasma contamination in cell culture in 1956, there have been frequent reports of mycoplasma contamination of cells and vaccines and other biological products at home and abroad. Mycoplasma is the simplest and smallest form of life in microorganisms. It is a kind of prokaryotic microorganisms lacking cell walls, and the size is generally between 0.3-0.5 μm. Because of its small size, mycoplasma can pass through the conventional filter used to filter microorganisms in CHO cell culture; and after mycoplasma infection, only a small amount of visible turbidity and cell damage are produced, resulti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/35
CPCC12Q1/686C12Q2545/101C12Q2547/101
Inventor 刘晓志周兴军董向峰常亮陈雪静刘素霞赵伟高健段宝玲
Owner NCPC NEW DRUG RES & DEV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More