Constitutive expression promoter and application thereof
A constitutive expression, promoter technology, applied in the field of plant biology, can solve problems such as insufficient
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The methods used in the following examples are conventional methods unless otherwise specified. The primers used are all synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and sequencing is completed by Beijing Huada Gene. PCR kits and endonucleases used in the construction of vectors are purchased From Bao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Company, and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the method provided in the kit. The carrier pHPG used in the experiment was modified from this experiment (the structural diagram of the carrier pHPG is figure 1 Shown), the basic skeleton comes from the pCAMBIA1303 of CAMBIA.
[0032] 1. Isolation and identification of promoter SOY001P
[0033] Design primers required for cloning promoter SOY001P:
[0034] Primer 1: 5'ggtacc ATAATGCATGTGCCTGACCAG 3'
[0035] Primer 2: 5'actagt AGTTGCAGAGAAGAGAATCGAA 3'
[...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap