Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase as well as encoding gene and application thereof

A technology of hydroxyoxymethyl and coding genes, which is applied in the six-position hydroxyoxymethyltransferase of the flavonoids of the purple back moss and its coding gene and application field, and can solve the problem of lack of the purple back moss of the blunt scale.

Inactive Publication Date: 2017-11-28
SHANDONG UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are relatively few studies on Vitiligo obtatus, and the isolation and identification of an oxymethyltransferase that can specifically catalyze the six-hydroxymethylation of flavonoids from Vitiligo obtatus has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase as well as encoding gene and application thereof
  • Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase as well as encoding gene and application thereof
  • Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1. Cloning of expression gene PaF6OMT

[0046] 1.1 CTAB-PVP method to extract total RNA

[0047] (1) Take the fresh plant material of Violet dorsalis, clean it, blot the excess water with filter paper, put it in a mortar and add liquid nitrogen to grind until the material becomes powder.

[0048] (2) Take an appropriate amount of powder into a pre-cooled centrifuge tube, add 800 μl 65°C preheated CTAB-PVP extract, and mix by inverting up and down.

[0049] The above-mentioned CTAB-PVP extraction buffer preparation method is as follows:

[0050] 100mM Tris HCl (pH 8.0), 2% CTAB (w / v), 2% PVP (w / v), 25mM EDTA, 2M NaCl, mercaptoethanol added to 0.2% after autoclaving; solution configuration was treated with DEPC ddH 2 O, after autoclaving for later use.

[0051] (3) Incubate at 65°C for 30 minutes, and mix by inverting every 6-10 minutes during this period.

[0052] (4) Add 600 μl of chloroform after cooling, mix well; centrifuge at 13,000 rpm at 4°C for 10 mi...

Embodiment 2

[0103] Example 2. Gene protein expression and enzyme activity analysis

[0104] 2.1 Construction of target gene prokaryotic expression vector

[0105] According to the sequence information of the target gene PaF6OMT and pET32a vector, select the appropriate restriction site to design the primers PaF6OMT-pET32a-F and PaF6OMT-pET32a-R of the prokaryotic expression vector:

[0106] PaF6OMT-pET32a-F:CGGGATCCATGGCCCCAGAGGTTTTGTC; (SEQ ID No. 5)

[0107] PaF6OMT-pET32a-R: CCCTCGAGCTACTTAAGAGTTGAAATGA; (SEQ ID No. 6)

[0108] Using the pMD19T-PaF6OMT plasmid as a template, the above primers were used to amplify its ORF, the PCR product was electrophoresed and gel recovered, and the vector pET32a and the gel recovered fragment were digested with BamH I and Xho I. The enzyme digestion system is as follows:

[0109]

[0110] Digestion was carried out in a water bath at 37°C for 3 hours. Add 10×Loading buffer to the digested product to terminate the reaction, then perform agarose g...

Embodiment 3

[0170] Embodiment 3.PaF6OMT enzymatic synthesis of homopsylloid and phyllogenin AA

[0171] In the in vitro enzyme function identification experiment, the PaF6OMT protein has a high selectivity for the methylation of 6-OH of baicalein and scutellarein, and the reaction product is single, and the conversion rate of the substrate is high, so it can be used for the enzymatic synthesis of Melaleuca Paper AA and Homo-Psyllogen.

[0172] 3.1 Effect of protein amount on substrate conversion rate

[0173] In order to study the effect of protein amount on the substrate conversion rate, we set the protein amount gradient of 1-14 μg in Tris-HCl (pH 7.5) buffer at 37°C, and the reaction time was 1h. The enzyme activity system is the same as above, wherein SAM and MgCI 2 The amount of added increases proportionally with the increase of protein amount. The effect of protein amount on the substrate conversion rate is as follows: Figure 5A .

[0174] 3.2 Effect of reaction time on subst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase as well as an encoding gene and application thereof. The amino acid sequence of the Plagiochasma appendiculatum flavone hexahydroxy o-methyltransferase is one of the following sequences: (1) an amino acid sequence represented by SEQ ID No.1; or (2) a protein with an amino acid sequence obtained by virtue of substitution and / or deletion and / or addition of the amino acid sequence represented by SEQ ID No.1 through one or several amino acid residues and has the same function. O-methyltransferase capable of efficiently catalyzing the methylation of flavone hexahydroxy is cloned from Plagiochasma appendiculatum for the first time, and an in vitro enzyme activity functional identification experiment proves that optimal substrates of PAf6OMT are baicalein and scutellarein. An experiment for testing the influence of the reaction time and the protein amount to a substrate conversion rate proves that baicalein and scutellarein can be completely catalyzed to respectively generate aoroxylia A and hispidulin in a certain period of reaction time by virtue of a proper protein amount.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a six-position hydroxyoxymethyltransferase of flavonoids in the purple back moss and its coding gene and application. Background technique [0002] Melaleucain A and homopsylloid are the products of 6-OH methylation of baicalein and scutellarein, which have a wide range of biological activities, such as anti-oxidation, anti-fungal, anti-inflammatory, anti-tumor, etc. It has been reported in the literature that celestialin A is the main active ingredient in the anti-tobacco drug Angongning currently used clinically. Homopsyllogen is the active metabolite of the traditional drug scutellarin in the body, but it has stronger biological activity and is easy to absorb when taken orally. Tumor, anti-virus, anti-hepatic fibrosis, anti-senile dementia, treatment of ischemic cerebrovascular disease, etc. Melaleucaine A and homopsyllogenin are expected to become the lead compo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P17/06C12R1/19
CPCC12N9/1007C12P17/06C12Y201/01084
Inventor程爱霞张玉莹许瑞雪
OwnerSHANDONG UNIV