Detection method of Vibrio parahaemolyticus
A hemolytic Vibrio and detection method technology, applied in the field of detection of Vibrio parahaemolyticus, can solve the problem of Vibrio parahaemolyticus, Salmonella, enterohaemorrhagic Escherichia coli, Mycobacterium tuberculosis, falciparum malaria, Vibrio cholerae Bacteria, Shigella, melon and fruit leaf spot bacteria, etc., to achieve high sensitivity, strong specificity, and improve detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The design and synthesis of embodiment 1 primer
[0039] Two pairs of primers and a pair of specific detection probes were designed according to the conserved region of the heat-labile hemolytic toxin gene tlh of Vibrio parahaemolyticus. The sequences are as follows:
[0040] The pair of peripheral primers are:
[0041] Forward peripheral primer VPOF: TGCGAAAGTGCTTGAGAT;
[0042] Reverse peripheral primer VPOR: GATGAGCGGTTGATGTCC.
[0043] The pair of cross-primers is:
[0044] Forward cross primer VPIF: TTCTGGCGCAGAAGTTAGGTTCATCAAGGCACAAGC;
[0045]Reverse cross primer VPIR: GTTCATCAAGGCACAAGCTTCTGGCGCAGAAGTTAG.
[0046] The pair of specific detection probes are:
[0047] Forward specific detection probe VPDF: CAAAGCGCAAGGTTACAACATCA, 3' end labeled with fluorescein isothiocyanate (Fitc);
[0048] Reverse specific detection probe VPDR: GAACAAGGCGTGAGTATCAAACAAC, 5' end labeled with biotin (Biotin).
Embodiment 2
[0049] The establishment of embodiment 2CPA method
[0050] The 20 μL constant temperature reaction system includes: peripheral primer 0.1 μmol / L, cross primer 0.4 μmol / L, specific detection probe 0.3 μmol / L, dNTPs 0.4 μmol / L, MgSO 4 6mmol / L, 10×Thermopolbuffer 2μL, BstDNA polymerase (U / μL) 8U, betaine 0.5mol / L, DNA 1μL.
[0051] CPA reaction program: constant temperature amplification at 63°C for 60min.
[0052] Detection of amplified products: After the amplification is completed, take 8-10 μL of the amplified products and add them dropwise to the sample loading area of the nucleic acid test strip. Place the test strips into the microwell plate containing 100 µL of buffer. After 15 to 30 minutes, it can be interpreted by the color development of the test strip.
Embodiment 3
[0053] Embodiment 3CPA-nucleic acid test strip method detection specificity
[0054] 10 different strains of Vibrio parahaemolyticus were detected, and the results were all positive. In order to further verify its specificity, Vibrio cholerae, Vibrio vulnificus, Vibrio alginolyticus, Salmonella, Escherichia coli, and Staphylococcus aureus were selected as control bacteria for testing, and the results showed that the results of the control bacteria were all negative. It is proved that the present invention has better specificity to Vibrio parahaemolyticus.
[0055] Sensitivity of CPA-nucleic acid test strips for detection of Vibrio parahaemolyticus. Calculate the concentration of the pure culture by counting plate colonies and perform a 10-fold serial dilution. The diluted culture is extracted with a bacterial genome extraction kit, and 1 μL of the extracted genome is used for CPA reaction detection. method sensitivity. After testing, the minimum detection limit of the prese...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 