Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method of Vibrio parahaemolyticus

A hemolytic Vibrio and detection method technology, applied in the field of detection of Vibrio parahaemolyticus, can solve the problem of Vibrio parahaemolyticus, Salmonella, enterohaemorrhagic Escherichia coli, Mycobacterium tuberculosis, falciparum malaria, Vibrio cholerae Bacteria, Shigella, melon and fruit leaf spot bacteria, etc., to achieve high sensitivity, strong specificity, and improve detection efficiency

Inactive Publication Date: 2016-03-30
JIMEI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the method combined with the detection method of colloidal gold nucleic acid test strips has been used in the detection of salmonella, enterohemorrhagic E. [4] Qi Jun, Zuo Feng, Liu Guohong, Liu Hongmei, Xu Gaolian, Zhang Xia. Detection of Salmonella by Isothermal Amplification Technique of Cross Primers [J]. Food Research and Development, 2013,34(2):67-70; [5] Qi Jun , Yu Zhirui, Zhan Xijing, Huang Jicheng, Li Zhizhi. Application of cross-primed isothermal amplification technology in rapid detection of falciparum malaria [J]. Chinese Journal of Vector Biology and Control, 2013,24(3):204-207), There are no reports for the detection of Vibrio parahaemolyticus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of Vibrio parahaemolyticus
  • Detection method of Vibrio parahaemolyticus
  • Detection method of Vibrio parahaemolyticus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The design and synthesis of embodiment 1 primer

[0039] Two pairs of primers and a pair of specific detection probes were designed according to the conserved region of the heat-labile hemolytic toxin gene tlh of Vibrio parahaemolyticus. The sequences are as follows:

[0040] The pair of peripheral primers are:

[0041] Forward peripheral primer VPOF: TGCGAAAGTGCTTGAGAT;

[0042] Reverse peripheral primer VPOR: GATGAGCGGTTGATGTCC.

[0043] The pair of cross-primers is:

[0044] Forward cross primer VPIF: TTCTGGCGCAGAAGTTAGGTTCATCAAGGCACAAGC;

[0045]Reverse cross primer VPIR: GTTCATCAAGGCACAAGCTTCTGGCGCAGAAGTTAG.

[0046] The pair of specific detection probes are:

[0047] Forward specific detection probe VPDF: CAAAGCGCAAGGTTACAACATCA, 3' end labeled with fluorescein isothiocyanate (Fitc);

[0048] Reverse specific detection probe VPDR: GAACAAGGCGTGAGTATCAAACAAC, 5' end labeled with biotin (Biotin).

Embodiment 2

[0049] The establishment of embodiment 2CPA method

[0050] The 20 μL constant temperature reaction system includes: peripheral primer 0.1 μmol / L, cross primer 0.4 μmol / L, specific detection probe 0.3 μmol / L, dNTPs 0.4 μmol / L, MgSO 4 6mmol / L, 10×Thermopolbuffer 2μL, BstDNA polymerase (U / μL) 8U, betaine 0.5mol / L, DNA 1μL.

[0051] CPA reaction program: constant temperature amplification at 63°C for 60min.

[0052] Detection of amplified products: After the amplification is completed, take 8-10 μL of the amplified products and add them dropwise to the sample loading area of ​​the nucleic acid test strip. Place the test strips into the microwell plate containing 100 µL of buffer. After 15 to 30 minutes, it can be interpreted by the color development of the test strip.

Embodiment 3

[0053] Embodiment 3CPA-nucleic acid test strip method detection specificity

[0054] 10 different strains of Vibrio parahaemolyticus were detected, and the results were all positive. In order to further verify its specificity, Vibrio cholerae, Vibrio vulnificus, Vibrio alginolyticus, Salmonella, Escherichia coli, and Staphylococcus aureus were selected as control bacteria for testing, and the results showed that the results of the control bacteria were all negative. It is proved that the present invention has better specificity to Vibrio parahaemolyticus.

[0055] Sensitivity of CPA-nucleic acid test strips for detection of Vibrio parahaemolyticus. Calculate the concentration of the pure culture by counting plate colonies and perform a 10-fold serial dilution. The diluted culture is extracted with a bacterial genome extraction kit, and 1 μL of the extracted genome is used for CPA reaction detection. method sensitivity. After testing, the minimum detection limit of the prese...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method for vibrio parahemolyticus and relates to vibrio parahemolyticus. Specific primers used for detecting vibrio parahemolyticus are a pair of outer primers, a pair of cross primers and a pair of specificity detection probes; the specific primers are designed according to the conserved region of the specific gene t l h of the vibrio parahemolyticus; the specific gene t l h of the vibrio parahemolyticus is the virulence genes of the coded vibrio parahemolyticus thermolabile hemolysin TLH. The detection method comprises the following steps: DNA extraction of a vibrio parahemolyticus template, validation of outer primers, establishment of a cross primers thermostatic amplification reaction system, establishment of cross primers thermostatic amplification reaction programs, and detection of amplification products. The detection method provided by the invention has the following advantages: the sensitivity is high and is ten times that of the common PCR; the specificity is strong and only vibrio parahemolyticus is detected so that detection results of other pathogenic bacterium are negative; the detection speed is high and the detection time is shortened to 1.5h to remarkably improve the detection efficiency; besides, the detection method is simple and convenient and practical: amplification products can be detected by a disposable test strip in 10 to 30 min.

Description

technical field [0001] The invention relates to vibrio parahaemolyticus, in particular to a detection method of vibrio parahaemolyticus. Background technique [0002] Vibrio parahaemolyticus, also known as halophilic bacteria, belongs to the Vibrio genus of the Vibrio family. It is a Gram-negative zoonotic bacterium that is widely distributed in seawater, seabed sediments, seafood and preserved foods near the coast. middle. The clinical symptoms of food poisoning caused by this bacteria are mostly acute enteritis, manifested as abdominal pain, diarrhea, and vomiting. May die due to untimely rescue. Food poisoning caused by Vibrio parahaemolyticus is related to ingestion of food containing the bacterium. Raw food or ingestion of undercooked contaminated seafood or preserved food is the main route of transmission. Known important sources of infection include crabs, shrimps, scallops, oysters, clams, jellyfish, cuttlefish, pickles, cured meat, etc. The optimum growth temper...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/63
CPCC12Q1/6844C12Q2565/625
Inventor 刘静雯徐苗苗
Owner JIMEI UNIV