A kind of primer and probe sequence for detection of Escherichia coli o157:h7 nucleotide fragment

An O157, Escherichia coli technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve problems such as low sensitivity or specificity, false positive PCR contamination, complicated and time-consuming operations, etc. Achieve the effect of avoiding false negative results, saving manpower and material resources, and saving testing time

Active Publication Date: 2015-08-19
JIANGSU ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the current detection methods of EHECO157:H7 mainly include conventional bacterial isolation and identification, gene chip technology, phage typing technology, pulsed field gel electrophoresis analysis technology, biosensor technology, ELISA established by monoclonal antibody, latex agglutination test, Immunomagnetic separation technology and colloidal gold immunochromatographic test strips, etc., but there are disadvantages such as complicated and time-consuming operations, high requirements for instruments, and low sensitivity or specificity
With the development of molecular biology technology, PCR is also widely used in the rapid diagnosis of EHECO157:H7 disease. This method is simple, convenient, fast and sensitive, but there are disadvantages such as false positive and PCR contamination.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of primer and probe sequence for detection of Escherichia coli o157:h7 nucleotide fragment
  • A kind of primer and probe sequence for detection of Escherichia coli o157:h7 nucleotide fragment
  • A kind of primer and probe sequence for detection of Escherichia coli o157:h7 nucleotide fragment

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0053] 6.3 Preparation of the template to be tested:

[0054] Add 10g of the positive beef samples prepared above to 90mL of phosphate buffer, shake at 37°C for 2h, then take 1mL and add it to 9mL heart and brain extract medium (Hangzhou Microbiological Reagent Products Co., Ltd.), and add 100uL to the medium Concentration is 50 mg / mL novobiocin (Ameresco imported packaging), continue to culture at 37°C for 18 hours, absorb 1 mL of culture, centrifuge at 500r for 15min, discard the precipitate, absorb the supernatant to a new centrifuge tube, centrifuge at 12000r for 10min, discard the supernatant, take The precipitate was resuspended in 1 / 10 volume of double distilled water, boiled water bath for 10 minutes, centrifuged at 12000 rpm at 4°C for 10 minutes, and the supernatant was absorbed, which was the template DNA for detection.

[0055] Take the above 1mL sewage sample and add it to 9mL heart and brain leaching solution medium (Hangzhou Microbial Reagent Products Co., Ltd.)...

Embodiment 7

[0059] Above-mentioned primer and probe detect clinical sample, comprise the following steps:

[0060] 7.1 Sample collection: collect 40 parts of cow feces, 25-30g / part; buy 6 parts of beef, 250g each in the market trade market; buy spinach, bean sprouts, leeks, water chestnuts and lettuce, 250g each, 30 parts in total . All collected and purchased samples were stored in sample collection bags (Nanjing Assistant Research Company), sealed and refrigerated.

[0061] 7.2 Preparation of the template to be tested:

[0062] Take out 10 grams of feces, beef or vegetables from the sample collection bag, add them to 90 mL of phosphate buffer solution, shake at 37°C for 2 hours, take 1 mL of it and add it to 9 mL of heart and brain extract medium (Hangzhou Microbiological Reagent Products Co., Ltd.), culture Then add 100uL of novobiocin with a concentration of 50mg / mL (imported by Ameresco) to the base, continue to incubate at 37°C for 18h, absorb 1mL of the culture, centrifuge at 500...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a primer and probe sequences for detecting nucleotide fragments of E. coli O157: H7, belonging to the technical field of biological and food testing. The primer comprises a primer pair consisting of an upstream primer pZF having the sequences of gccaggcaaatatgtttgtga and a downstream primer pZR having the sequences of catttggcatttgaacgatgaa. The probe pZP has the sequences of cctggataccgctactcaaattctgtcaaaat. The set of primers and probes are designed according to the GenBank E. coli O157: H7 EDL933 (perservation number: AE005174) and have high sensitivity and specificity.

Description

1. Technical field [0001] The invention belongs to the technical field of biology and food detection. In particular, it relates to a primer and a probe sequence for detecting Escherichia coli O157:H7 nucleotide. 2. Background technology [0002] Enterohemorrhagic E.coli (EHEC) O157:H7 is a common enteropathogenic bacterium, which can cause diarrhea, hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura Severe complications can lead to death, with a fatality rate of 5% to 10%. [0003] In 1982, Riley et al. reported the outbreak of hemorrhagic colitis caused by EHECO157:H7, which was also the first report that EHECO157:H7 was identified as a serious pathogen. Subsequently, there were many infections of this bacteria in Canada, Japan, the United Kingdom, Australia and other places. In 1999, O157:H7 infectious diarrhea broke out in my country's Anhui and Jiangsu provinces, with more than 20,000 patients and 177 deaths. The epidemic lasted for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11
CPCC12Q1/686C12Q2563/107
Inventor张雪寒何孔旺栾晓婷汪伟温立斌李彬王小敏
OwnerJIANGSU ACAD OF AGRI SCI