Congenital aniridia disease-causing gene, kit for detecting congenital aniridia disease-causing gene and application of gene

A disease-causing gene and aniridia technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems that can only be seen under gonioscopy

Active Publication Date: 2014-07-23
HARBIN MEDICAL UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinically, in some affected eyes, the residual peripheral iris can be seen with a flashlight or during slit lamp examination, while some residual iris root tissue can only be seen under gonioscopy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Congenital aniridia disease-causing gene, kit for detecting congenital aniridia disease-causing gene and application of gene
  • Congenital aniridia disease-causing gene, kit for detecting congenital aniridia disease-causing gene and application of gene
  • Congenital aniridia disease-causing gene, kit for detecting congenital aniridia disease-causing gene and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Preparation of a kit for detection of congenital aniridia disease-causing genes

[0054] 1. Design and synthesis of primer pairs

[0055] Primer 1: CGTAAGCTTGTCATTGTTTAATGC (shown in SEQ ID NO: 1)

[0056] Primer 2: AGAGAGGGTGGGAGGAGGTA (shown in SEQ ID NO: 2);

[0057] It was synthesized by an automatic DNA synthesizer and diluted to 20 μmol / L.

[0058] 2. Assembling the kit

[0059] Including: 2mM dNTP, 10×PCR reaction buffer, DNA polymerase, PCR amplification primer pair and double distilled water.

Embodiment 2

[0060] Example 2 Application of a kit for detection of congenital aniridia pathogenic gene in clinical detection

[0061] 1. Test samples and experimental materials:

[0062] Experimental materials: Genomic DNA extraction kit QIAamp DNA Blood Mini Kit was purchased from QIAGEN; PCR detection kit was purchased from Qiagen, Hilden, Germany.

[0063] Test samples: A family with congenital aniridia was collected clinically. Family members were investigated and visited or had a general examination to exclude other diseases and systemic abnormalities. Detailed ophthalmic examinations, including visual acuity, slit-lamp microscopy, and dilated fundus examinations, were performed on family members. All patients were photographed under a slit lamp microscope. All family members who participated in the investigation and were blood samples were understood the purpose and meaning of this study and signed the informed consent. There were 4 generations in this family, 36 family members,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a congenital aniridia disease-causing gene, a kit for detecting the congenital aniridia disease-causing gene and an application of the gene. The congenital aniridia disease-causing gene is a mutational PAX6 (Paired box6) gene, one point of a basic group in a 323th site of a sixth exon of the PAX6 gene is muted to A from C, and a genetic codon (TCC) for encoding serine at a 108th site is changed into a genetic codon (TAC) for encoding tyrosine, namely S108Y mutation is caused. The invention also provides a kit used for detecting the congenital aniridia disease-causing gene. The kit used for detecting the congenital aniridia disease-causing gene comprises 2mM dNTPs, 10*PCR (Polymerase Chain Reaction) buffer solution, DNA polymerase, PCR amplification primer pairs and double distilled water, wherein the PCR amplification primer pair is composed of a primer 1 (shown in SEQ ID NO:1) and a primer 2 (shown in SEQ ID NO:2). The invention provides a new congenital aniridia disease-causing gene, so that a new technological means is provided for genetic diagnosis of congenital aniridia, and a foundation is also laid for study of a pathogenetic molecular mechanism.

Description

technical field [0001] The present invention relates to a gene detection kit and its application, in particular to a congenital aniridia disease-causing gene detection kit and its application. The invention belongs to the technical field of disease detection and diagnosis. Background technique [0002] Aniridia is a developmental disorder of the eyes. The main feature is congenital iris dysplasia or the absence of a normal iris. Strabismus, nystagmus, etc., involving the whole eyeball. [0003] Due to the different degrees of iris defect, the clinical manifestations are different, but they all have photophobia, frowning and squinting, and poor vision and may progressively decrease. Clinically, in some affected eyes, the remaining peripheral iris can be seen with a flashlight or during slit lamp examination, while in some cases, the remaining iris root tissue can only be seen under gonioscopy. Many patients have peripheral corneal pannus and corneal opacity in the early st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12Q1/68
Inventor 张璐
Owner HARBIN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap