A method for identifying whether the species to be tested is China Cotton Research Institute 63 and its special primer set

A primer pair and auxiliary identification technology, which is applied in the direction of biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of affecting the promotion effect of hybrid cotton, female parent doping, and unsatisfactory identification results, etc.

Active Publication Date: 2016-06-22
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the hybrid seed production of cotton is still dominated by artificial seed production, and the sterile line seed production has not been promoted. With the continuous rise of labor costs, the cost of hybrid seed production is getting higher and higher, and the quality of seeds is getting worse. The hybrid cotton seeds sold are seriously fake, with F 2 Replace F 1 , with regular cotton instead of F 1 , there are phenomena such as female parent doping, so that the hybrids cannot achieve the due effect of increasing production in the promotion, and affect the promotion effect of hybrid cotton
Conventional field identification takes a long time, which will affect the sales of seeds in the current year, and the identification effect is not very satisfactory due to the impact of the environment during the Jiadai identification in Hainan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for identifying whether the species to be tested is China Cotton Research Institute 63 and its special primer set
  • A method for identifying whether the species to be tested is China Cotton Research Institute 63 and its special primer set
  • A method for identifying whether the species to be tested is China Cotton Research Institute 63 and its special primer set

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, the construction of the DNA fingerprint collection of China Cotton Research Institute 63

[0030] 1. Screening of SSR primer pairs

[0031] After screening a large number of cotton SSR primers, it was found that 30 SSR primer pairs (see Table 1 for nucleotide sequences) could be used to make the DNA fingerprint of Zhongmian Research Institute 63.

[0032] Nucleotide sequence of table 130 primer pairs

[0033] serial number

Primer name

Forward primer (5'→3')

Reverse primer (5'→3')

1

CIR062

TTTAGAGGAGAAGTTTAGG (sequence 1)

CAGTCTCTTGTAGTTTCATT (sequence 2)

2

CS62

GATGGCTACCTCCCCTTTGTA (sequence 3)

CGTAAGGAAGCCTAGCAAAA (sequence 4)

3

NAU1070

ACCAACAATGGTGACCTCTT (Sequence 5)

CCCTCCATAACCAAAAGTTG (sequence 6)

4

NAU1102

ATCTCTCTGTCTCCCCCCTTC (sequence 7)

GCATATCTGGCGGGTATAAT (sequence 8)

5

NAU1186

AATGGTCCTGCTCCAGATT (sequence 9)

AATCGTCGTCGTCGAAT...

Embodiment 2

[0073] Example 2, application of 30 SSR primer pairs to aid in the identification of China Cotton Research Institute 63

[0074] The following cotton varieties were tested: Zhongzhimian No. 2 (Plant Protection Institute, Chinese Academy of Agricultural Sciences), Ruiza 816 (Jinan Xinrui Seed Industry), Han 8266 (Handan Academy of Agricultural Sciences), Zhongmian Institute 63 ( China Cotton Seed Industry).

[0075] Detection method: extract the genomic DNA of cotton leaves, use the genomic DNA as a template, carry out PCR amplification with the 30 SSR primer pairs respectively, and then perform 8% polyacrylamide gel electrophoresis and silver staining for color development.

[0076] The PCR system and PCR reaction procedures are the same as in Example 1.

[0077] Electropherogram see Figure 31 (1, 2, 3, and 4 represent Zhongmian Institute 63, Zhongzhimian No. 2, Ruiza 816, and Han 8266, respectively). The band results are shown in Table 3.

[0078] Table 3 adopts 30 pairs...

Embodiment 3

[0113] Embodiment 3, application 20 primer pairs in 30 SSR primer pairs identify seed purity

[0114] Receive a batch of China Cotton Institute 63 (in the form of seeds, a total of 200 grains from the seed production company; the seeds are theoretically China Cotton Institute 63, but usually due to the limited operating level in the seed production process, it is difficult to achieve 100% purity. female parent plant phenomenon or other doping phenomenon), randomly select 26 seeds from 200 seeds, extract the genomic DNA of the kernel respectively, use the genomic DNA as a template, and use 20 SSR primer pairs respectively (see the table for specific SSR primer pairs) 4) Perform PCR amplification, and then perform 8% polyacrylamide gel electrophoresis and silver staining for color development. Using the genomic DNA of the male parent (2 repeated samples) of Zhongmian Institute 63 as a template, 20 SSR primer pairs were used for PCR amplification, and then 8% polyacrylamide gel e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
elongation at breakaaaaaaaaaa
reflectanceaaaaaaaaaa
Login to view more

Abstract

The invention discloses a method and a special primer set for identifying facticity of to-be-tested variety belonging to CCRI 63. The method provided by the invention comprises the following steps: respectively carrying out PCR (Polymerase Chain Reaction) amplification by use of CIR62, CS62, NAU1070, NAU1102, NAU1186, NAU2026, NAU2173, NAU2277, NAU2343, NAU1196, NAU1085, NAU1255, NAU1369, NAU1233, NAU1269, NAU2272, NAU1187, NAU1375, CS51, NAU1028, NAU2342, NAU868, HAU1300, NAU6094, DPL0238, NAU1362, NAU859, HAU2786, CGR6410 and NAU0478 primers, if a PCR amplification product meets more than 28 standards in the standards of 1)-30), and the to-be-tested cotton is CCRI 63, wherein the genomic DNA of to-be-tested cotton is taken as a template. The method disclosed by the invention can be applied to controlling the quality of cotton seeds, ensuring the quality of commercially available CCRI 63 seeds and fighting against counterfeiting CCRI 63 seeds.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for identifying whether a variety to be tested is Zhongmian Institute 63 and a special primer set thereof. Background technique [0002] Cotton has obvious heterosis. Hybrid cotton varieties have been used for many years, and the effect of increasing yield is obvious, and they have been popularized and applied in a large area. At present, the hybrid seed production of cotton is still dominated by artificial seed production, and the sterile line seed production has not been promoted. With the continuous rise of labor costs, the cost of hybrid seed production is getting higher and higher, and the quality of seeds is getting worse. The hybrid cotton seeds sold are seriously fake, with F 2 Replace F 1 , with regular cotton instead of F 1 , There are phenomena such as female parent doping, so that the hybrids cannot achieve the due effect of increasing production i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q2531/113C12Q2565/125
Inventor 付小琼叶武威杨付新黄殿成
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap