Expression system of a xylose-utilizing yeast candida jeffriesii
An expression system and xylose technology, applied in the field of genetic engineering, can solve the problem that conventional expression vectors are difficult to yeast expression system and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] Example 1: Construction of PR series integrated expression vectors
[0088] 1. Construction of recombinant plasmid pMD-18s rDNA
[0089] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.
[0090] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'
[0091] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'
[0092] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.
[0093] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...
Embodiment 2
[0152] Example 2: Establishment of PEG / LiAc-mediated transformation method of Candida jeffriesii.
[0153] Using Candida jeffriesii NRRL Y-27738 as the host bacterium, the method of transforming yeast mediated by PEG / LiAc is implemented as follows:
[0154] 1. Preparation of Competent Candida jeffriesii NRRL Y-27738
[0155] (1) Inoculate the Candida jeffriesii NRRL Y-27738 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.
[0156] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.
[0157] (3) Pick a single colony of Candida jeffriesii NRRL Y-27738 from the YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask.
[0158] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches about 1.2.
[0159] (5) C...
Embodiment 3
[0174] Example 3: Establishment of the yeast Candida jeffriesii transformation method mediated by electroporation
[0175] Using Candida jeffriesii NRRL Y-27738 as the host bacterium, the electroporation method was used to mediate the transformation of yeast as follows:
[0176] 1. Preparation of Candida jeffriesii NRRL Y-27738 electroporation competent cells
[0177] (1) Inoculate the Candida jeffriesii NRRL Y-27738 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours;
[0178] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;
[0179] (3) Pick a single colony of Candida jeffriesii NRRL Y-27738 from the YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask;
[0180] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution rea...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com