Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression system of yeast namely Candida jeffriesii capable of using xylose

An expression system, xylose technology, applied in the field of genetic engineering, can solve problems such as yeast expression system that is difficult for conventional expression vectors

Active Publication Date: 2015-04-29
JIANGNAN UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are a variety of expression vectors used in expression systems such as Saccharomyces cerevisiae and Pichia pastoris on the market, this yeast belongs to xylose-utilizing yeast and uses a special gene coding system. The codon CUG codes for serine instead of leucine (Wohlbach DJ, Kuo A, Sato TK, Potts KM, Salamov AA, Labutti KM, Sun H, Clum A, Pangilinan JL, Lindquist EA, Lucas S, Lapidus A, Jin M, Gunawan C, Balan V, Dale BE, Jeffries TW, Zinkel R,Barry KW,Grigoriev IV,Gasch AP.Comparative genomics of xylose-fermenting fungi for enhanced biofuel production.Proceedings of the National Academy of Sciences of the United States of America,2011,108(32):13212-13217.) , so the above-mentioned conventional expression vectors are difficult to adapt to the yeast expression system through modification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression system of yeast namely Candida jeffriesii capable of using xylose
  • Expression system of yeast namely Candida jeffriesii capable of using xylose
  • Expression system of yeast namely Candida jeffriesii capable of using xylose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1: Construction of PR series integrated expression vectors

[0088] 1. Construction of recombinant plasmid pMD-18s rDNA

[0089] (1) According to the whole genome sequence of Spathaspora passalidarum (GenBank accession NZ_AEIK00000000), two primers were designed to intercept the partial sequence of Spathaspora passalidarum 18s rDNA as the homologous recombination site. The primer sequences are as follows: the underlined part of primer P1 is the recognition site of EcoR I, and the underlined part of primer P2 is the recognition site of Bgl II, BamH I and Kpn I respectively from the 5' to 3' ends.

[0090] P1: 5'GCCG GAATTC TGCCAGTAGTCATATGCTTGTCTC3'

[0091] P2: 5'ATATTAGG GGTACC CG GGATCC GA AGATCT GTTGAAGAGCAATAAT3'

[0092] (2) Cultivate Spathaspora passalidarum overnight, collect cells, separate and extract genomic DNA.

[0093] (3) Spathaspora passalidarum genomic DNA was used as a template, and PCR amplification was performed with primers P1 and ...

Embodiment 2

[0152] Example 2: Establishment of PEG / LiAc-mediated transformation method of Candida jeffriesii.

[0153] Using Candida jeffriesii NRRL Y-27738 as the host bacterium, the method of transforming yeast mediated by PEG / LiAc is implemented as follows:

[0154] 1. Preparation of Competent Candida jeffriesii NRRL Y-27738

[0155] (1) Inoculate the Candida jeffriesii NRRL Y-27738 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours.

[0156] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C.

[0157] (3) Pick a single colony of Candida jeffriesii NRRL Y-27738 from the YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask.

[0158] (4) Inoculate 50ml of YPD culture medium with the fresh bacterial solution cultivated overnight, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution reaches about 1.2.

[0159] (5) C...

Embodiment 3

[0174] Example 3: Establishment of the yeast Candida jeffriesii transformation method mediated by electroporation

[0175] Using Candida jeffriesii NRRL Y-27738 as the host bacterium, the electroporation method was used to mediate the transformation of yeast as follows:

[0176] 1. Preparation of Candida jeffriesii NRRL Y-27738 electroporation competent cells

[0177] (1) Inoculate the Candida jeffriesii NRRL Y-27738 stored in the cryopreservation tube into the YPD medium, and activate the shake flask for 48 hours;

[0178] (2) Streak the activated bacterial solution on the YPD plate and store it at 4°C;

[0179] (3) Pick a single colony of Candida jeffriesii NRRL Y-27738 from the YPD plate, inoculate it in 20ml of YPD medium, and culture it overnight at 30°C in a 100ml shake flask;

[0180] (4) Inoculate the overnight cultured fresh bacterial solution into 50ml YPD medium, and culture it in a 250ml shake flask at 30°C and 200rpm until the OD600 of the bacterial solution rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an expression system of a yeast namely Candida jeffriesii capable of using xylose. The expression system comprises an expression vector, wherein the following elements are operationally connected from 5'-3' in sequence: a pMD19-Tsimple plasmid skeleton, a rDNA homologous recombination sequence, an exogenous gene expression box and a screening marker gene expression box; the exogenous gene expression box sequentially comprises a promoter, an exogenous gene insertion restriction enzyme cutting site and a transcription terminator from upstream to downstream; and the screening marker gene expression box comprises a promoter, an antibiotic resistance gene and a transcription terminator. The expression vector provided by the invention can be integrally and stably expressed in Candida jeffriesii, and the expression system is of great significance for basic theory researches and product development of the yeast namely Candida jeffriesii capable of using xylose.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to an expression system of yeast Candida jeffriesii capable of utilizing xylose, a construction method and application thereof. Background technique [0002] On the basis of the development of molecular biology, genetics, biochemistry, microbiology and other disciplines, genetic engineering technology appeared in the 1970s. This technology constitutes a new combination of genetic material by inserting nucleic acid molecules into plasmids or other carrier molecules in vitro, and is stably amplified and expressed in a new genetic background after being introduced into host cells. The expression of functional genes is very important for the study of the structure and function of the encoded protein and its practical application, and it can be expressed in different expression systems. At present, a variety of expression systems for gene function research and protein expres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N15/66C12N1/19C12R1/72
Inventor 张梁范贺超高芝李由然石贵阳顾正华李赢丁重阳何冬旭
Owner JIANGNAN UNIV