A strain of Trichosporium yeast and its application in the synthesis of gold nanoparticles
A gold nanoparticle, yeast technology, applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: the acquisition of bacterial strain
[0020] Trichosporon in this application is isolated from the activated sludge of Benxi Iron and Steel Coking Plant. In the early stage, the mud sample was placed in a microbial reactor for domestication and cultivation. After 60 days, 2 mL of the reactor mud-water mixture was taken, and the mud-water mixture was diluted and coated on the solid modified Martin liquid containing tetracycline and oxytetracycline by using the plate dilution coating method. Medium (glucose 10g / L, (NH 4 ) 2 SO 4 1g / L, MgSO 4 0.5g / L, K 2 HPO 4 1g / L, tetracycline 0.05g / L; oxytetracycline 0.05g / L, pH 7, agar 2wt%), cultured at 30°C for 5 days. After the growth of colonies on the petri dish, pick a small amount of colonies and place them in a 50mL Erlenmeyer flask containing 25mL of liquid modified Martin's medium, shake and cultivate them at 30°C and 150rpm. Flat coating. Repeat the above operations until a purified strain is obtained. ...
Embodiment 2
[0022] Embodiment 2: 26S rRNA molecular identification of bacterial strain
[0023] Genomic DNA of Trichosporium yeast WIN was extracted, the 26S rRNA gene sequence was amplified by PCR and sequenced, and the sequence was compared using BLAST program, and the most similar species was Trichosporium yeast, and the 26S rRNA gene sequences of the two were The similarity was 100%, so it was determined that WIN was Trichosporon. figure 1 It is the phylogenetic tree of strain WIN gene. Its 26S rRNA sequence has been registered in the GenBank database, and the accession number is KP676895. The 26Sr RNA gene sequence of strain WIN is as follows.
[0024] >WIN 26S rRNA gene sequence
[0025] CTCAAATTTGAAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGAAGCGTTTTCCGTGCTGAACTGTGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATCATCAGTGCTCTGTGATACGTTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACG...
Embodiment 3
[0026] Embodiment 3: the growth curve of trichosporon yeast WIN
[0027] Utilize the bacterium liquid in embodiment 1, adopt 115 ℃, the solid improved Martin culture medium (glucose 10g / L, (NH 4 ) 2 SO 4 1g / L, MgSO 4 0.5g / L, K 2 HPO 4 1g / L, tetracycline 0.05g / L; oxytetracycline 0.05g / L, pH 7), 30°C, cultured at 150rpm, the inoculum size was 10%. The growth of bacteria was detected by ultraviolet spectrophotometry under the absorbance of bacteria liquid at 660nm, and the growth of bacterial strain WIN was as follows: figure 2, the strain enters the stationary phase after 108h of growth, and the logarithmic growth phase is 12-108h.
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



