Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A strain of Trichosporium yeast and its application in the synthesis of gold nanoparticles

A gold nanoparticle, yeast technology, applied in the biological field

Inactive Publication Date: 2017-05-03
DALIAN UNIV OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Trichosporon involved in this patent is a widespread fungus, some of which are related to sewage treatment, and several species can produce biosurfactants and microbial diesel, and the synthesis of AuNPs by Trichosporon research has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of Trichosporium yeast and its application in the synthesis of gold nanoparticles
  • A strain of Trichosporium yeast and its application in the synthesis of gold nanoparticles
  • A strain of Trichosporium yeast and its application in the synthesis of gold nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: the acquisition of bacterial strain

[0020] Trichosporon in this application is isolated from the activated sludge of Benxi Iron and Steel Coking Plant. In the early stage, the mud sample was placed in a microbial reactor for domestication and cultivation. After 60 days, 2 mL of the reactor mud-water mixture was taken, and the mud-water mixture was diluted and coated on the solid modified Martin liquid containing tetracycline and oxytetracycline by using the plate dilution coating method. Medium (glucose 10g / L, (NH 4 ) 2 SO 4 1g / L, MgSO 4 0.5g / L, K 2 HPO 4 1g / L, tetracycline 0.05g / L; oxytetracycline 0.05g / L, pH 7, agar 2wt%), cultured at 30°C for 5 days. After the growth of colonies on the petri dish, pick a small amount of colonies and place them in a 50mL Erlenmeyer flask containing 25mL of liquid modified Martin's medium, shake and cultivate them at 30°C and 150rpm. Flat coating. Repeat the above operations until a purified strain is obtained. ...

Embodiment 2

[0022] Embodiment 2: 26S rRNA molecular identification of bacterial strain

[0023] Genomic DNA of Trichosporium yeast WIN was extracted, the 26S rRNA gene sequence was amplified by PCR and sequenced, and the sequence was compared using BLAST program, and the most similar species was Trichosporium yeast, and the 26S rRNA gene sequences of the two were The similarity was 100%, so it was determined that WIN was Trichosporon. figure 1 It is the phylogenetic tree of strain WIN gene. Its 26S rRNA sequence has been registered in the GenBank database, and the accession number is KP676895. The 26Sr RNA gene sequence of strain WIN is as follows.

[0024] >WIN 26S rRNA gene sequence

[0025] CTCAAATTTGAAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGAAGCGTTTTCCGTGCTGAACTGTGTCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGATAATCCCGTACTTGACACAATCATCAGTGCTCTGTGATACGTTCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACG...

Embodiment 3

[0026] Embodiment 3: the growth curve of trichosporon yeast WIN

[0027] Utilize the bacterium liquid in embodiment 1, adopt 115 ℃, the solid improved Martin culture medium (glucose 10g / L, (NH 4 ) 2 SO 4 1g / L, MgSO 4 0.5g / L, K 2 HPO 4 1g / L, tetracycline 0.05g / L; oxytetracycline 0.05g / L, pH 7), 30°C, cultured at 150rpm, the inoculum size was 10%. The growth of bacteria was detected by ultraviolet spectrophotometry under the absorbance of bacteria liquid at 660nm, and the growth of bacterial strain WIN was as follows: figure 2, the strain enters the stationary phase after 108h of growth, and the logarithmic growth phase is 12-108h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to a trichosporium yeast and its application in the synthesis of gold nanoparticles, which belong to the field of microorganism technology. The strain was isolated from laboratory reactor sludge, and was deposited in the General Microbiology Center of China Committee for the Collection of Microbial Cultures on January 19, 2015, with the preservation number CGMCC No.10368. According to the 26S rRNA gene sequence, the strain has the highest similarity (99%) with Trichosporon, so the strain is named Trichosporon montevideense, and the GenBank accession number of the 26S rRNA gene sequence of the strain is KP676895. The optimum temperature for the strain to grow in the modified Martin's medium was 30°C, and the optimum pH was 6. The strain has the ability to quickly synthesize gold nanoparticles, and can catalyze chloroauric acid to start synthesizing gold nanoparticles within 3 to 6 minutes, and reach the peak of synthesis within 10 minutes, which shows its potential application value in the field of biometallurgy.

Description

technical field [0001] The invention relates to a Trichosporium yeast strain and its application in the synthesis of gold nanoparticles, belonging to the field of biotechnology. [0002] technical background [0003] Gold nanoparticles (AuNPs) are widely used in microbiology, medicine, environmental sensing, and electronics due to their antioxidant properties, biocompatibility, and stability. The existing AuNPs synthesis methods all have certain limitations. In the physical synthesis method, AuNPs with small particle size (diameter <10nm) and uniform size distribution can be synthesized by optimizing the laser pulse time and action temperature. However, these methods require high temperature and high pressure conditions and complex instrumentation. However, refractory non-polar organics, which are often used in chemical reduction synthesis methods, will have a negative impact on the environment. The sol-gel method can obtain AuNPs with a smaller size and shape distribut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12P3/00C12R1/645
CPCC12N1/16C12P3/00C12N1/145C12R2001/645
Inventor 曲媛媛王经伟沈文丽李端行刘紫嫣李会杰马桥周集体
Owner DALIAN UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com