Growth-related site sma‑usc114 and detection primers in turbot
A technology of sma-usc114 and turbot, applied in the field of molecular biology, can solve the problems of difficult growth performance of newly established families, and achieve the effect of rich polymorphism and convenient verification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Utilize described primer to carry out PCR amplification to turbot sample DNA, described Sma-USC114 primer sequence is as follows: R:TCTATCCCCTGTTGGTGTC, F:AAGGTTGTGAGTGTTTGGTG
[0022] Primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.
[0023] Described PCR reaction system:
[0024] The 15 μl system is as follows: 1.3 μl of 10×buffer, 1.1 μl of dNTP, 0.7 μl of upstream and downstream primers, 1.0 μl of template DNA, ddH 2 O 10 μl, rTaq enzyme 0.2 μl.
[0025] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, the annealing temperature was set according to the primer annealing temperature, annealing for 30 s, extension at 72°C for 30 s, a total of 35 cycles; final extension at 72°C for 7 min, and storage at 4°C.
[0026] The denaturation reaction procedure: 95° C. for 5 minutes, add 4.5 μl of denaturation buffer to each PCR sample, which includes formamide, 0.5×EDTA, bromophe...
Embodiment 2
[0032] The selection of embodiment 2 turbot growth fast group and slow growth group
[0033] Take the fast-growing strain F constructed in Yantai in 2013 3 An 8-month-old turbot family raised in the same pond measured and recorded the body length and weight data of 300 turbot in this family, and established a normal distribution map of body length and weight, see figure 1 and figure 2, discard 90% of the intermediate type of body length and weight, and finally determine the use of individuals whose body length is greater than 19cm and body weight higher than 144g in this family to construct the F (fast) group; Individuals construct S(slow) groups. 30 tails were taken from each of the two groups, and the living bodies were transported back to the laboratory, the caudal fins were clipped, DNA was extracted, and stored at -20°C. Prepare for SSR analysis of fast-growing and slow-growing individuals.
[0034] (1) PCR reaction:
[0035] The 15μl system is as follows: 1.3μl of ...
Embodiment 3 2
[0047] Embodiment 3 secondary experimental verification
[0048] In order to expand the scope of application of this mark, the turbot was verified twice as an 8-month-old turbot raised in the same pond in the Rizhao Farm, and the body length and weight of 300 of them were measured to establish a normal relationship between body length and weight. state distribution diagram, see Figure 4 and Figure 5 , to remove 90% of the intermediate body length and weight individuals, the same as Section 2. Finally, it was determined that the individuals whose body length was longer than 17cm and whose weight was more than 140g were named F (fast) group; those whose body length was less than 9cm and whose weight was less than 65g were named S (slow) group. Using this as a standard, 30 tails were taken from each of the two groups, and the living bodies were transported back to the laboratory, the caudal fins were clipped, DNA was extracted, and stored at -20°C. For SSR analysis.
[0049...
PUM
| Property | Measurement | Unit |
|---|---|---|
| body length | aaaaa | aaaaa |
| body length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More