A single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin b1

An aflatoxin and oligonucleotide technology, applied in the biological field, can solve the problems of reduced sensitivity of trace detection, cumbersome preparation of monoclonal antibody or polyclonal antibody, easy loss of activity, etc., and achieves easy chemical modification and transformation, easy detection, The effect of reducing the cost of experiments

Active Publication Date: 2017-12-29
ZHEJIANG PUZHENG DETECTING TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] For immunological detection, the preparation of monoclonal antibody or polyclonal antibody is cumbersome, the activity is easily lost when fixed, and cross-reaction is prone to occur in the presence of homologous proteins. Some small molecules that are difficult to produce antibodies cannot be detected by antigen-antibody method. Reduced sensitivity for detection of trace amounts
Liquid chromatography is easy to operate, accurate in quantification, and suitable for the analysis of a large number of samples, but the samples need to be purified in the early stage, and the equipment is expensive, so it has not been widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin b1
  • A single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin b1
  • A single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin b1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] The implementation of the present invention is described in more detail below through examples, but the present invention is not limited to these examples, and these examples do not limit the scope of the present invention in any way.

[0035] 1. Construct a random single-stranded DNA (ssDNA) oligonucleotide library (5'-TGGGATACGCATGCGTCGTATT(N38)ATGCGCTCAATGGGAGACTTTA -3'), where N38 is a random sequence of 38 bases, and both ends are primer sequences with fixed sequences, Primer P1 is 5'-TGGGATACGCATGCGTCGTATT-3', primer P2 is 5'-TAAAGTCTCCCCATTGAGCGCAT-3', the library capacity is 10 15 , the random single-stranded DNA oligonucleotide library was made into ssDNA stock solution with a concentration of 10 μM in TE buffer, and stored at -20°C for later use;

[0036] 2. Aflatoxin B1 pretreatment:

[0037] Activate the aflatoxin B1 to bring carboxyl groups, use the EDC-NHS connection method to immobilize the aflatoxin B1 on the surface of the aminated magnetic beads, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin B1; the purpose of the invention is to provide a single-stranded DNA oligonucleotide that can highly specifically recognize aflatoxin B1 The acid aptamer can quickly and accurately detect aflatoxin B1 in food through the labeling method. In the present invention, the common aflatoxin B1 in foods and grains is used as a target substance, and a nucleic acid aptamer sequence specifically binding to aflatoxin B1 is obtained by using SELEX technology, and the aptamer can be transformed by labeling a reporter molecule In order to report nucleic acid aptamers, combined with conventional detection methods such as gold standard test paper, fluorescent reporter detection, and enzyme-linked immunoassay technology (ELISA method), the rapid detection of aflatoxin B1 in food can be realized, and it can be synthesized in large quantities and is easy It is chemically modified and has high stability, and is widely used in food testing, basic research, clinical diagnosis, and drug research.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a single-stranded DNA oligonucleotide aptamer specifically recognizing aflatoxin B1. Background technique [0002] Aflatoxin is a molecular mycotoxin, which is a metabolite produced by Aspergillus flavus and Aspergillus parasitica. It is a highly toxic and strong carcinogen, and is the most stable of all mycotoxins found so far. The chemical structure of aflatoxin has been determined more than 10 kinds such as B1, B2, G1, G2, M1 and M2. Among them, the most toxic is aflatoxin B1 (Aflatoxin B1 is abbreviated as AFB1), its toxicity is 10 times that of potassium cyanide and 68 times that of arsenic, it can cause great damage to liver cells and kidney cells, The poisoned person may die due to liver failure and uremia, and it also has carcinogenic, teratogenic, and mutagenic effects. Aflatoxin mainly exists in food, oil and its products contaminated by aflatoxin, such as rice, beans, pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12N15/10
Inventor 佟勇于合国刘富平姜鹏
Owner ZHEJIANG PUZHENG DETECTING TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap