A kind of her2 nucleic acid aptamer and its application

A nucleic acid aptamer and nucleotide sequence technology, which can be used in pharmaceutical formulations, DNA/RNA fragments, gene therapy, etc., and can solve problems such as reducing the binding ability of nucleic acid aptamers and target molecules

Active Publication Date: 2018-02-09
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the modification of the ribose 2' position can enhance the resistance of oligonucleotides to nucleases, it often reduces the binding ability of the nucleic acid aptamer to the target molecule

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of her2 nucleic acid aptamer and its application
  • A kind of her2 nucleic acid aptamer and its application
  • A kind of her2 nucleic acid aptamer and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The preparation of embodiment 1HB3-1, HB3

[0059] In the present invention, the core sequence of the HER2 nucleic acid aptamer is a single-stranded nucleotide with a length of 43 bases, and its nucleotide sequence is: 5'GTGTGTCTGCTATTTATTTTGCTTGATTATCTCTTAGGGATTT3'; the preferred HER2 nucleic acid aptamer is 59 bases The length of single-stranded nucleotides, the sequence is: 5'TGCCCGTGTCCCGAGGAGTGCCCTATTTTGCTTGATTATCTCTAAGGGATTTGGGCGG-3'; more preferably, when synthesizing, all the bases A in the above-mentioned sequence are modified with sulfur to obtain a sulfur-substituted HER Nucleic acid aptamers, named respectively (the core sequence is thiolated (HB3-1), the preferred sequence is thiolated (HB3)), the above sequences were synthesized by Invitrogen Company. The structure of HB3 aptamer is as figure 1 In the figure, A is the primary sequence and B is the secondary structure.

[0060] Hereinafter, if there is no special statement, the terms "HB3" and "thio-HB3" ...

Embodiment 2

[0061]Example 2 The ability of HB3-1 to bind to HER2 polypeptide

[0062] HB3-1 modified with biotin (biotin) at the 3' end and fluorescein (FITC) at the 5' end was mixed with HER2 polypeptide, trypsin and HER2 polypeptide in 200 μl of binding buffer (PBS buffer with pH 7.4), respectively. The IgG-coated magnetic beads were reacted at 37°C for 30 min, washed twice with PBS, and analyzed by flow cytometry. The primary structure of the modified HB3-1 is as follows:

[0063] 5'FITC-GTGTGTCTGCTATTTATTTTGCTTGATTATCTCTTAGGGATTT-biotin-3'. Base A in the sequence is a sulfur modification.

[0064] Under the same conditions, we detected the binding of base A to HER2 polypeptide when it was not thiomodified.

[0065] The result is as figure 2 , where (A) the binding of HER2 polypeptide-coated magnetic beads to FITC-labeled HB3-1; (B) the binding of IgG antibody-coated magnetic beads to FITC-labeled HB3-1; (C) trypsin-coated beads Binding of magnetic beads to FITC-labeled HB3-1; (D...

Embodiment 3

[0066] Example 3 The ability of HB3-1 to bind to HER2-positive tumor cells

[0067] SK-BR-3 cells were cultured in modified RPMI1640 containing 15% FBS, MDA-MB-231 cells were cultured in DMEM high glucose medium containing 10% FBS, 100 U / ml penicillin and 100 mg / ml streptomycin, All cells were kept at 37°C, 5% CO 2 The cells were cultured in an incubator, and the cells used in the following experiments were all cells in the logarithmic growth phase.

[0068] Scrape 5×10 separately 5 The SK-BR-3 and MDA-MB-231 cells were reacted with HB3-1 (biotin modified at the 3' end and fluorescein at the 5' end) in 200 μl binding buffer (PBS) at 37 °C for 30 min, Washed twice with PBS and analyzed by flow cytometry. see the results image 3 , (A) HER2 positive SK-BR-3 cells. (B) HER2 negative MDA-MB-231 cells. The black curve is the control fluorescence signal generated by the random library single-stranded DNA, and the gray curve is the fluorescence signal generated by thio-HB3-1. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a nucleic acid aptamer specifically binding to HER2 polypeptide or HER2-positive tumor cells. The two ends of the aptamer can be modified by groups, and the groups are amino, amino, carboxyl, sulfhydryl, Any one or more of fluorescent molecules, cholesterol or polyethylene glycol; the base of the aptamer can be modified in any way, and the modification is any of thio, amino, fluoro, methoxy or carboxyl or multiple modifications. It also relates to the application of the above-mentioned nucleic acid aptamer in preparing preparations for detecting and / or treating HER2-positive breast cancer. The prepared preparation for treating HER2-positive breast cancer can selectively bind to HER2-positive breast cancer cells, but weakly bind to HER2-negative breast cancer cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to a nucleic acid aptamer that can be combined with a human epidermal growth factor receptor 2 (HER2) molecule, in particular to a HER2 nucleic acid aptamer that can resist nucleases and the application of the nucleic acid aptamer in the preparation of preparations for detecting and / or treating HER2-positive breast cancer. Background technique [0002] Breast cancer is one of the common malignant tumors in women, of which about 20-30% are overexpressed by human epidermal growth factor receptor 2 (HER2). Compared with other types of breast cancer, HER2-positive breast cancer is more malignant, progresses faster, is more likely to recur and metastasize to distant sites, and is less sensitive to chemotherapy drugs. In addition, more than 50% of HER2-positive breast cancers lack estrogen and progesterone receptors, so that these patients are not sensitive to endocrin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12Q1/68A61K48/00A61P35/00
Inventor 杨先达胡燕
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap