Unlock instant, AI-driven research and patent intelligence for your innovation.
Method and kit for detecting homozygous/heterozygous state of transgenic maize t4-1-1 exogenous gene
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of transgenic corn and foreign genes, applied in the directions of biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc.
Active Publication Date: 2018-04-13
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0004] So far, there is no detection method for the homozygous / heterozygous state of the exogenous gene of transgenic corn T4-1-1 at home and abroad, only to determine whether the transgenic corn T4-1-1 sample contains genetically modified ingredients or what kind of genetically modified Element
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0023] Example 1 Establishment of PCR detection method for homozygous / heterozygous state of exogenous gene in transgenic maize T4-1-1
[0024] 1. Primer design and sequence
[0025] The exogenous integration structure of the transformant is located on chromosome 1 of the maize genome, wherein the primer T4-1-1-F is located on the 5' end of the maize genome; the primer T4-1-1-R is located on the 3' end of the maize genome.
[0026] Primer sequence
[0027] T4-1-1-F: TTAGCAGAGTCGTGAGAGTTTAG (SEQ ID No. 1)
[0028] T4-1-1-R: TAGTAAATGTGATGAAACCATGAA (SEQ ID No. 2)
[0029] 2. PCR amplification reaction system and reaction procedure:
[0030] Reaction system: 10×LA Taq Buffer II (Mg 2+ Plus) buffer 2.5 μL, TaKaRa LA Taq (5U / μl) polymerase 0.25 μL, dNTP Mixture (2.5mM each) 4.0 μL, 10 μmol / L Primer shown in SEQ ID No.1 1 μL, 10 μmol / L SEQ ID No .1 μL of the primer indicated in 2, 2 μL of 25ng / μL DNA template, and make up to 25 μL with deionized water.
[0031] PCR amplificati...
Embodiment 2
[0034] Example 2 Application Experiment of PCR Detection of Transgenic Maize T4-1-1 Exogenous Gene Homozygous / Heterozygous State
[0035] 1. Plant material
[0036] 1. Transgenic maize T4-1-1 homozygote;
[0037] 2. Non-transgenic rice: T4-1-1 receptor;
[0038] 3. Mixed samples of T4-1-1 receptors and transgenic maize T4-1-1 homozygotes.
[0039] 2. Experimental method
[0040] (1) Extraction and detection of plant genomic DNA
[0041] 1. DNA Extraction from Plant Material
[0042] Plant genomic DNA extraction kit DP305 (Tiangen Biochemical Technology Co., Ltd.) was used to extract and purify the genomic DNA of transgenic maize T4-1-1 and its recipient maize. For the extraction steps, please refer to the kit instructions.
[0043] 2. DNA detection
[0044] When using UV spectrophotometer to detect DNA concentration and purity, DNA should have a significant absorption peak at OD260, and the ratio of OD260 / OD280 should be 1.7-1.9.
[0045] (2) Establishment of PCR react...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a method for detection homozygous or heterozygous state of insertion of an exogenous gene of genetically-modified corn T4-1-1. The method includes that a PCR detection primer is designed, DNA extracted from a to-be-detected sample is used as a template, the primer is used for PCR amplification, and the homozygous or heterozygous state of insertion of the exogenous gene can be determined according to DNA fragments obtained by amplification. The invention further provides a PCR detection kit used for detecting the homozygous or heterozygous state of insertion of the exogenous gene of the genetically-modified corn T4-1-1.
Description
Technical field: [0001] The invention relates to a method for detecting the homozygous / heterozygous state of transgenic maize T4-1-1 exogenous gene insertion, and also relates to a reagent kit for the above detection. Background technique [0002] In the detection of genetically modified crops, it is not only necessary to know whether the sample contains genetically modified components, what kind of genetically modified components are contained, and sometimes it is necessary to confirm the homozygous or heterozygous state of the foreign DNA insertion. This qualitative detection of genetically modified ingredients is also known as screening testing. [0003] In the detection of genetically modified components, exogenous DNA can be regarded as a gene locus. The target nucleic acid sequence detected in the homozygous diploid genome, that is, the copy number of the foreign DNA insertion characteristic sequence is 2; the copy number of the foreign DNA insertion characteristic se...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/686C12N15/11
CPCC12Q1/686C12Q2531/113
Inventor 张维周正富余桂容郭翠徐利远林敏
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Login to View More 
Login to View More