A strain of Streptomyces clavulatum with high activity clavulanate aminoacetylase and its application

A technology of acid aminoacetylase and Streptomyces clavulatus, which is applied in the field of microbial breeding and biology, can solve the problem of difficult selection of genetic modification sites, and achieve the effects of reducing randomness and blindness, high efficiency, and strong pertinence

Inactive Publication Date: 2016-08-31
SHANDONG MEDICAL BIO TECH RES CENT +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is expected to obtain clavulanic acid high-yielding bacteria by genetically modifying clavulanate aminoacetylase, but because the site of genetic modification is difficult to select, there is no research on genetic modification of clavulanate aminoacetylase. Clavulanic acid high producing bacteria were reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of Streptomyces clavulatum with high activity clavulanate aminoacetylase and its application
  • A strain of Streptomyces clavulatum with high activity clavulanate aminoacetylase and its application
  • A strain of Streptomyces clavulatum with high activity clavulanate aminoacetylase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Obtaining target genes containing mutated bases by continuous error-prone PCR

[0034] Mutation of the clavulanate aminoacetylase gene in vitro using sequential error-prone PCR. Specifically:

[0035] 1. The primers for error-prone PCR are:

[0036] Sequence of upstream primer GcasForward: GCTCTAGAGCCCGCAGTGTGATGAAG;

[0037] Downstream primer GcasReverse sequence: GCGAATTCGGGTGGCGTCTCCGCTCACG.

[0038] 2. PCR system: template DNA 2ul, PCR buffer 5ul, Taq DNA polymerase 1ul, dATP 1~3ul, dTTP1~3ul, dGTP 1~3ul, dCTP 1~3ul, upstream primer 2ul, downstream primer 2ul, 25mM MgCl 2 1~8ul, 5mMMnCl 2 0~1ul, add ultrapure water to 50ul.

[0039] 3. PCR conditions: pre-denaturation at 97°C for 10 minutes, denaturation at 97°C for 30 seconds, annealing at 52-62°C for 30 seconds, extension at 72°C for 2 minutes, 35 cycles, and final extension for 10 minutes.

[0040]The template DNA for the first PCR was derived from the industrial strain Streptomyces clavulus B02,...

Embodiment 2

[0042] Example 2: Construction of a library of clavulanic acid aminoacetylase mutants from Streptomyces clavulanate

[0043] The continuous error-prone PCR products in Example 1 were double-digested with XbaI and BamHI, and the digested products were recovered after gel agarose electrophoresis separation, and combined with the same double-digested shuttle vector pSET152 (pSET152 is a prior art Conventional plasmids) were ligated, transformed into Escherichia coli DH5a, and the transformants were picked to extract the plasmids for double enzyme digestion identification.

[0044] Using conjugative transfer technology, the recombinant pSET152 was transferred into the clavulaminic acid aminoacetylase gene deletion strain of Streptomyces clavulinus strain B02 (the gene deletion strain was obtained by conventional gene knockout technology based on strain B02), and a series of Zygotes to construct a mutant library of the clavulanate aminoacetylase gene.

Embodiment 3

[0045] Example 3: Plate screening of zygotes

[0046] Escherichia coli with β-lactamase was used as an indicator bacterium, and ampicillin-containing LA was used to make a screening plate, and the Streptomyces clavulatus zygote (prepared in Example 2) was screened by the plate transparent circle method. First, 6897 zygotes were transferred to BSCA solid plates and cultured at 25°C for 6 days, then excavated zygote agar blocks with a diameter of 6 mm, placed on a screening plate, cultured at 37°C for 16 hours, and measured the diameter of the transparent circle (see figure 1 ). At the same time, strain B02 was used as a control. The larger the diameter of the transparent circle, the greater the ability to synthesize clavulanic acid. A total of 564 positive mutant strains were selected, which were continued to be cultured until sporulation and were numbered B02-1 to B02-564.

[0047] The spores of 564 positive mutants were diluted to 10 5 1 / ml, take 100ul and spread on BSCA so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-activity aminoacetylase clavulanate streptomyces clavuligerus strain. The clavulanate streptomyces clavuligerus strain is clavulanate streptomyces B02-246, is preserved in the China general microbiological culture collection center (CGMCC) on October 13, 2015 and has a preservation number of CGMCC NO. 11484. A sequential error-prone PCR method is used for in-vitro mutation of a gene of the aminoacetylase clavulanate, an aminoacetylase clavulanate-less strain is used as a starter, through a conjugational transfer technology, a clavulanate streptomyces gene-containing mutant library is built, a positive mutant is screened, and through fermentation verification and subculture, the clavulanate streptomyces B02-246 with stable genetic characters is obtained. The strain has a clavulanic acid synthesis level 1.3 times higher than that of the original strain B02 and can be used for industrial fermentation production.

Description

technical field [0001] The invention belongs to the field of microbial breeding and biotechnology, and in particular relates to a strain of Streptomyces clavulatum with high-activity clavulanate aminoacetylase and application thereof. Background technique [0002] Clavulanic acid (clavulanic acid) is a commonly used β-lactamase inhibitor in clinical practice. It can be used in combination with amoxicillin or ticarcillin to enhance the antibacterial activity of the antibiotic against drug-resistant strains and improve the clinical efficacy. clinical value. [0003] Clavulanic acid is a secondary metabolite synthesized by Streptomyces clavuligerus, and its industrial production method is microbial fermentation and extraction and refining. The current fermentation level is an important factor determining the production cost of clavulanic acid, so the development of high-yielding strains of clavulanic acid has very important industrial value. The clavulanic acid yield of wild-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/78C12N15/55C12N1/21C12N15/11C12P17/18C12R1/465
CPCC12N9/78C12P17/188
Inventor曹广祥钟传青
OwnerSHANDONG MEDICAL BIO TECH RES CENT