A preparation method of oral recombinant nutritional polypeptide supplementing human essential amino acids
A technology of nutritional polypeptides and recombinant plasmids is applied in the field of preparation of oral recombinant nutritional polypeptides, which can solve the problems of complex separation and purification process of nutritional polypeptides, and achieve the effects of easy industrial amplification and cultivation, strong survivability and broad market value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Cloning, sequencing and identification of nutritional polypeptide np gene
[0040] The gene of nutritional polypeptide NP was amplified from the synthetic DNA fragment purchased by the company (Shanghai Sangong) by PCR.
[0041] The PCR amplification primers of the nutritional polypeptide np gene fragment are:
[0042] Np-F: GG GGTACC CC CTGAAGGTGACCATCAAGAC
[0043] Np-R: CG GAATTC CG TCCTTGGTCACCAGCAGGATCAC
[0044] The PCR reaction system was carried out strictly according to the instruction manual of TaKaRa LA Taq. The 20 μL reaction system contained 0.2 μL of TaKaRaLA Taq, 10×LA PCR Buffer Ⅱ (Mg 2+Plus) 2 μL, dNTP Mixture (2.5 mM each) 3.2 μL, template DNA 100 ng, upstream and downstream primers (20 μM) 0.4 μL, and finally add sterilized ultrapure water to make up to 20 μL. The PCR conditions are: denaturation at 94°C for 5 minutes, 1 minute at 94°C, 40s at 56°C, and 40s at 72°C, 30 cycles. The size of the PCR product is 180bp, including the c...
Embodiment 2
[0045] Example 2: Preparation and application of Bacillus subtilis recombinant spores displaying NP on the surface of the carrier using CotC
[0046] 1. Construction of recombinant integrated plasmid pJS700-NP
[0047] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang, the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5'-end and amyE 3'-end respectively represent the 5' end and 3' end of the coding sequence of the amylase gene amyE (Gene Bank sequence number: NP_388186), which are integrated into Bacillus subtilis 168 by homologous recombination (trp - ) in the amylase gene of the chromosome. Amps r ,Em r Represent ampicillin resistance gene and erythromycin resistance gene respectively, in Escherichia co...
Embodiment 3
[0059] Example 3: Functional analysis of oral administration of recombinant spores in mice to improve exercise efficiency
[0060] In this experiment, 5-week-old healthy ICR mice (20-25g) were selected for oral spore experiment. Experimental mice were bred in full compliance with the requirements and guidance of the Experimental Animal Center of Yangzhou University. The breeding temperature was controlled at 25±1°C, and sufficient drinking water was provided. Before the formal experiment, the acute toxicology experiment of spores was carried out in advance. Select 5 mice, orally administer recombinant spores to the mice at a dose of 5 mg / g body weight, and then observe for a week. After all the physiological activities of the mice are found to be normal, the next step of the experiment is carried out.
[0061] Take 46 ICR mice (20-25g), provided by the Animal Center of Yangzhou University. They were randomly divided into 5 groups, with 6 rats in the control group and 10 rats ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com