Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof

A human serum albumin, Bacillus subtilis technology, applied in the direction of serum albumin, albumin peptides, animal/human proteins, etc., can solve the problems of complex separation and purification process of human serum albumin, and achieve simple preparation method and separation process. Fast, good stability, overcoming the complex effect of separation and purification process

Inactive Publication Date: 2011-09-14
JIANGSU UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention of this product overcomes the current limitation that human serum albumin is derived from blood products, and also overcomes the shortcomings of the complicated separation and purification process of human serum albumin produced by recombinant yeast fermentation, and has a good application prospect in the field of pharmacy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof
  • Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof
  • Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: human serum albumin hsa Cloning, sequencing and identification of genes

[0030] Human liver tissue samples were provided by Dr. Liu Jibing, School of Medicine, Nantong University. Take human liver tissue, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen for grinding, use RNA extraction kit to isolate messenger RNA (mRNA), and obtain the cDNA sequence of human serum albumin gene by RT / PCR technology.

[0031] human serum albumin hsa The primers for PCR amplification of gene fragments are:

[0032] hsa-F: ATGGTACCATGAAGTGGGTAACCTTT

[0033] hsa-R: GCGAATTCTTATAAGCCTAAGGCAGCT

[0034] PCR reaction system according to TaKaRa LA Taq The instructions for use are strictly followed, and the 20 μL reaction system contains TaKaRa LA Taq 0.2μL, 10×LA PCR BufferⅡ(Mg 2+ Plus) 2 μL, dNTP Mixture (2.5 mM each) 3.2 μL, template DNA 100ng, upstream and downstream primers (20 μM) 0.4 μL, and finally add sterilized ultrapure water to make ...

Embodiment 2

[0036] Example 2: Preparation of Bacillus subtilis recombinant spores displaying HSA on the surface of the carrier using CotC

[0037] 1. Construction of recombinant integrated plasmid pJS700-HSA

[0038] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang (preserved in the 403 Laboratory of Biochemistry and Molecular Biology, Jiangsu University Institute of Life Sciences), the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5'-end and amyE 3'-end respectively represent the amylase gene amyE (Gene Bank sequence number: NP_388186) The 5' and 3' ends of the coding sequence were integrated into the Bacillus subtilis 168 ( trp - ) in the amylase gene of the chromosome. Amps r ,Em r Represent ampici...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of recombinant fusion protein medicaments. In the method, capsid protein genes cotC of spores of bacillus subtilis are used as molecular vectors and are recombined with human serum albumin hsa genes, so that integrated recombinant plasmid for fusion expression is constructed; after the bacillus subtilis is transformed through the recombinant plasmid for fusion expression of the human serum albumin HAS, exogenous genes are integrated in amylase genes amyE at specific sites on chromosomes through homologous recombination, and the amylase genes are subjected to insertional inactivation, so that a recombinant strain has no amylase activity, the recombinant bacillus subtilis strain comprising fusion expression CotC-HAS is successfully screened, and the human serum albumin is displayed on the surface of the spore produced by inducing the recombinant strain. The recombinant spore can be directly and orally taken by animals; and the recombinant spore has a part of medicinal effects and nutrition functions of the human serum albumin on the basis of keeping physiological property of the spore.

Description

technical field [0001] The invention relates to a preparation method and product of recombinant spores displaying foreign proteins on the surface, specifically referring to recombinant spores displaying human serum albumin HSA on the surface of Bacillus subtilis spores, belonging to the technical field of recombinant fusion protein drugs. Background technique [0002] Human serum albumin (human serum albumin, HSA) is a single-chain aglycosylated protein composed of 585 amino acids, with a molecular mass of about 66.5 kD (Mingetti, et al. 1986. J.Biol.Chem. 261,6757 ), the isoelectric point is between 4.7 and 4.9. HSA is the most abundant protein in human plasma, accounting for about 60% of total plasma protein. Human serum albumin can transport fatty acids, bile pigments, amino acids, steroid hormones, metal ions, and many therapeutic molecules in body fluids, while maintaining blood osmotic pressure at an appropriate level. Since HSA is the most important carrier of blood...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12N1/21C12R1/125
CPCA61K35/742C07K14/32C12N15/1037C07K14/765A61K38/385C07K2319/00C12N15/75
Inventor 陈克平毛浪勇宁德刚李国辉姚勤
Owner JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More