Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof
A human serum albumin, Bacillus subtilis technology, applied in the direction of serum albumin, albumin peptides, animal/human proteins, etc., can solve the problems of complex separation and purification process of human serum albumin, and achieve simple preparation method and separation process. Fast, good stability, overcoming the complex effect of separation and purification process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: human serum albumin hsa Cloning, sequencing and identification of genes
[0030] Human liver tissue samples were provided by Dr. Liu Jibing, School of Medicine, Nantong University. Take human liver tissue, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen for grinding, use RNA extraction kit to isolate messenger RNA (mRNA), and obtain the cDNA sequence of human serum albumin gene by RT / PCR technology.
[0031] human serum albumin hsa The primers for PCR amplification of gene fragments are:
[0032] hsa-F: ATGGTACCATGAAGTGGGTAACCTTT
[0033] hsa-R: GCGAATTCTTATAAGCCTAAGGCAGCT
[0034] PCR reaction system according to TaKaRa LA Taq The instructions for use are strictly followed, and the 20 μL reaction system contains TaKaRa LA Taq 0.2μL, 10×LA PCR BufferⅡ(Mg 2+ Plus) 2 μL, dNTP Mixture (2.5 mM each) 3.2 μL, template DNA 100ng, upstream and downstream primers (20 μM) 0.4 μL, and finally add sterilized ultrapure water to make ...
Embodiment 2
[0036] Example 2: Preparation of Bacillus subtilis recombinant spores displaying HSA on the surface of the carrier using CotC
[0037] 1. Construction of recombinant integrated plasmid pJS700-HSA
[0038] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang (preserved in the 403 Laboratory of Biochemistry and Molecular Biology, Jiangsu University Institute of Life Sciences), the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5'-end and amyE 3'-end respectively represent the amylase gene amyE (Gene Bank sequence number: NP_388186) The 5' and 3' ends of the coding sequence were integrated into the Bacillus subtilis 168 ( trp - ) in the amylase gene of the chromosome. Amps r ,Em r Represent ampici...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 