Preparation method for oral recombinant nutritive polypeptide supplementing human body essential amino acids
A technology of nutritional polypeptides and recombinant strains is applied in the field of preparation of oral recombinant nutritional polypeptides, which can solve the problems of complex separation and purification process of nutritional polypeptides, and achieve the effects of easy industrial amplification and cultivation, large specific gravity, and simple and convenient cultivation methods.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Nutritional peptides np Gene cloning, sequencing and identification
[0041] The gene for the nutritional polypeptide NP was amplified from the synthetic DNA fragment (Shanghai Shenggong) purchased by the company by PCR.
[0042] Nutritional peptides np The primers for PCR amplification of gene fragments are:
[0043] Np-F: GG GGTACC CC GACGATGACGATAAG CTGAAGGTGACCATCAAGAC
[0044] Np-R: CG GAATTC CG TCACTTGTCGTCATCGTCTTTGTAG TC CTTGGTCACCAGCAGGATCAC
[0045] PCR reaction system TaKaRaLATaq The instructions for use are strictly carried out, and the 20μL reaction system contains TaKaRaLATaq 0.2μL, 10×LAPCRBufferⅡ(Mg 2+ Plus) 2μL, dNTPMixture (2.5mM each) 3.2μL, template DNA 100ng, upstream and downstream primers (20μM) each 0.4μL, and finally add sterile ultrapure water to make up to 20μL. The PCR conditions were: denaturation at 94°C for 5 min, 94°C for 1 min, 56°C for 40s, 72°C for 40s, 30 cycles. PCR product size is 180bp, including nutritional peptides ...
Embodiment 2
[0046] Example 2: Preparation and application of recombinant Bacillus subtilis spores displaying NP on the surface of CotC
[0047] 1. Construction of recombinant integrated plasmid pJS700-NP
[0048] Plasmid pJS700 (Li Qian. Research on the recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX as a molecular carrier [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38), by Ningde, School of Environment, Jiangsu University As a gift from Associate Professor Gang, the size of the plasmid is approximately 5.5kb. In the pJS700 plasmid, amyE 5’-end and amyE 3’-end respectively represents the amylase gene amyE (GeneBank sequence number: NP_388186) The 5’ end and 3’ end of the coding sequence are integrated in the Bacillussubtilis 168( trp - ) In the amylase gene of the chromosome. Amp r , Em r Respectively represent the ampicillin resistance gene and erythromycin resistance gene, in E. coli and Bacillussubtilis 168( trp ...
Embodiment 3
[0060] Example 3: Functional analysis of mouse oral administration of recombinant spores to improve exercise efficiency
[0061] In this experiment, 5-week-old healthy ICR mice (20-25g) were used for oral spore experiment. The experimental mice were reared completely in accordance with the requirements and instructions of the Experimental Animal Center of Yangzhou University. The feeding temperature is controlled at 25±1℃, and sufficient drinking water is provided. Acute toxicological experiments of spores were carried out before the formal experiment. Five mice were selected, and the recombinant spores were orally administered to the mice at a dose of 5 mg / gram body weight at one time, and then observed for a week. After all the physiological activities of the mice were found to be normal, proceed to the next experiment.
[0062] Take 46 ICR mice (20-25g), provided by the Animal Center of Yangzhou University. Randomly divided into 5 groups, 6 in the control group and 10 in the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 