Unlock instant, AI-driven research and patent intelligence for your innovation.

Lamp detection primer set, lamp detection kit and detection method of transgenic insect-resistant soybean mon87701 and its derivatives

A technology of MON87701 and detection kit, which is applied in the field of molecular biology, can solve problems such as difficult on-site detection, low sensitivity, and affecting detection accuracy, and achieve the effect of simple operation and mild conditions

Active Publication Date: 2019-03-12
SHANGHAI IGENETEC DIAGNOSTICS CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] 1) Protein-based detection, now the most widely used detection methods are enzyme-linked immunosorbent assay (ELISA) and Western blot detection methods, which require high-quality, high-specificity antibodies, otherwise it will affect the accuracy of detection, low sensitivity;
[0008] 2) DNA-based detection is mainly for the detection of exogenously inserted genes in transgenic crops, mainly including molecular hybridization technology, PCR detection technology and chip detection technology, among which PCR detection method is the most important and most accurate detection of genetically modified crops method, but the reaction system and operation process of this type of method are relatively complicated, and professionals are required; a specific PCR instrument is required, and the amplification time is 2 to 3 hours. Strong toxicity, and difficult to implement on-site detection
[0010] Loop-Mediated Isothermal Amplification technology (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene amplification technology developed by Notomi and Okayama around 2000. It has the advantages of fast and simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies constant temperature amplification visual detection technology and constant temperature real-time fluorescence technology to the rapid detection of transgenic insect-resistant soybean MON87701 and its derivatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lamp detection primer set, lamp detection kit and detection method of transgenic insect-resistant soybean mon87701 and its derivatives
  • Lamp detection primer set, lamp detection kit and detection method of transgenic insect-resistant soybean mon87701 and its derivatives
  • Lamp detection primer set, lamp detection kit and detection method of transgenic insect-resistant soybean mon87701 and its derivatives

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Kit and detection method containing chromogenic agent

[0069] A LAMP detection kit, including primer solution, reaction solution, DNA polymerase, control and chromogenic reagent:

[0070] (1) Primer solution: Contains 50 μM outer primer 1, 50 μM outer primer 2, 50 μM inner primer 1, 50 μM inner primer 2, the four primers are:

[0071] Outer primer 1: GATATGAAGATACATGCTTAGCA (SEQ ID No: 1);

[0072] Outer primer 2: CGACCACGGAAAAAAAACAC (SEQ ID No: 2);

[0073] Internal primer 1: CAGATTGTCGTTTCCCGCCTTCACGCTTAGTGTGTGTGTC (SEQ ID No: 3);

[0074] Inner primer 2: CGGGGGATCCACTAGTTCTTAGTGAATTCGAGCTCGGTAC (SEQ ID No: 4).

[0075] (2) Reaction solution: containing 12mM dNTP, 10×Isothermal Amplification reaction buffer, 150mMMgSO 4 Aqueous solution, the volume ratio of the three is 8:5:2;

[0076] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0077] (4) Control: Escherichia coli plasmid DNA containing the target gene, and the negative con...

Embodiment 2

[0100] Embodiment 2 The kit and detection method thereof without chromogenic agent

[0101] The kit is the same as that in Example 1 except that it lacks the chromogenic agent and fluorescent indicator in Example 1.

[0102] Use the above kit to detect the sample to be tested in the following way:

[0103] 1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0104] 2) Constant temperature detection reaction: prepare a reaction system in a 200ul PCR tube: 1.8μl primer solution, 15.2μl reaction solution, 1μl DNA polymerase, 1-6μl DNA to be tested, make up to 25μl with DNase / RNase-Free Distilled Water; set For the positive control reaction, use the DNA of transgenic insect-resistant soybean MON87701 or E. coli plasmid DNA containing the target gene to replace the DNA to be tested; when setting the negative control reaction, use the reaction mixture without the target gene to replace the DNA to be tested;...

Embodiment 3

[0108] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention

[0109] Prepare the LAMP detection kit of transgenic insect-resistant soybean MON87701 according to the following formula:

[0110] (1) Primer solution: Contains 50 μM outer primer 1, 50 μM outer primer 2, 50 μM inner primer 1, 50 μM inner primer 2, the four primers are:

[0111] Outer primer 1: GATATGAAGATACATGCTTAGCA (SEQ ID No: 1);

[0112] Outer primer 2: CGACCACGGAAAAAAAACAC (SEQ ID No: 2);

[0113] Internal primer 1: CAGATTGTCGTTTCCCGCCTTCACGCTTAGTGTGTGTGTC (SEQ ID No: 3);

[0114] Inner primer 2: CGGGGGATCCACTAGTTCTTAGTGAATTCGAGCTCGGTAC (SEQ ID No: 4).

[0115] (2) Reaction solution: containing 12mM dNTP, 10×Isothermal Amplification reaction buffer, 150mMMgSO 4 Aqueous solution, the volume ratio of the three is 8:5:2;

[0116] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0117] (4) Control: the positive control is E. coli plasmid D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a LAMP detection primer set, a LAMP detection kit and a detection method of the transgenic insect-resistant soybean MON87701 and its derivative varieties. The LAMP detection primer set includes four specific primers; the detection kit includes a primer solution, a reaction solution, and a DNA polymerase. and control; the kit can also have a chromogenic agent or a fluorescent indicator; the detection method is to extract the DNA of the sample to be tested, using four specific primers and a DNA polymerase with strand displacement activity, at 60-65 ° C Amplify the sample DNA template, and the short-term amplification efficiency can reach 10 9 ~10 10 The identification uses the turbidity change of the precipitate in the reaction tube, adding a chromogen to observe the color change in the reaction tube, and using a real-time fluorescence detector to observe and determine whether the sample to be tested contains transgenic insect-resistant soybean MON87701 and its derivatives. The invention has the advantages of rapidity and high efficiency, simple operation, high specificity, high sensitivity, simple identification, suitable for on-site detection and the like, and is suitable for popularization and application.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a LAMP detection primer set, a LAMP detection kit and a detection method of transgenic insect-resistant soybean MON87701 and its derivative varieties. Background technique [0002] Transgenic technology was first successfully developed in 1973 by Tanley Cohen, a professor at Stanford University. Genetically modified soybeans are one of the examples of the successful application of genetically modified technology in crops. The world's first genetically modified soybean plant was born in 1988. In 1994, the glyphosate-resistant genetically modified soybeans launched by Monsanto Company of the United States were approved for commercial production. Soybean planting area expanded rapidly. The application of transgenic technology and the commercialization of global transgenic plant cultivation provide an effective way to solve the problem of food shortage. [0003] Soybean i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2600/13C12Q2531/119
Inventor 王欣珍方雪恩孔凡树陈旭徐凌佳孔继烈
Owner SHANGHAI IGENETEC DIAGNOSTICS CO LTD