Chimeras of brucella lumazine synthase and beta subunit of ab5 toxins
What is AI technical title?
AI technical title is built by Patsnap AI team. It summarizes the technical point description of the patent document.
一种二氧四氢蝶啶、布鲁氏菌的技术,应用在寡聚蛋白复合体领域,能够解决Stx2B差免疫原等问题
Active Publication Date: 2016-05-04
INMUNOVA
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0021] Although multiple approaches exist, no successful Stx2B-based immunogens have been obtained, mainly because Stx2B is a very poor immunogen (Marcato et al., 2001. J Infect Dis 183:435-443; Imai et al., 2004. InfectImmun72(2):889- 895)
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0094] Molecular modeling of the chimeric protein BLS-Stx2
[0095] The chimera was designed by modeling its theoretical structure with the program PyMOL1.5 (www.pymol.org), combining the C-terminus of the Stx2B (PDB code: IR4P) structure with the BLS (PDB code: ID10) The N-terminus of the crystal structure was fused, a strategy similar to that previously described by Laplagne et al. (Laplagne et al., 2004. Proteins 57:820-828). The coding sequence of the first 8 residues at the end of BLSN was replaced with the coding sequence of Stx2B and the flexible G / S pentapeptide peptide linker, decapeptide peptide linker or 15 amino acid peptide linker connecting the two proteins. Both Stx2B and BLS form the same C5 symmetric pentameric structure, where each protomer interacts with the other two. The theoretical structure of the chimera obtained by molecular modeling ( figure 1 ) demonstrated that all linkers used were long enough to allow assembly of the Stx2B pentamer onto the pent...
Embodiment 2
[0097] The pET11a-BLS-Stx2B-L5 (joint with 5 amino acids) plasmid containing the gene with SEQ.ID.No.4 was constructed by the following scheme:
[0098] a) In order to clone the coding gene of 2,4-dioxotetrahydropteridine synthase (BLS) of Brucella (Brucellaspp.), utilize specific primer to amplify from Brucella abortus (B. abortus) genomic DNA to obtain the BLS sequence, and cloned into the pET11a vector (Novagen, USA). To develop the expression cassette, directed mutagenesis was performed on the sequence encoding the open reading frame of Brucella 2,4-dioxopteridine synthase (BLS) (Laplagne et al., 2004). Insert two new restriction sites in the 5' region of the BLS gene: an NsiI site in the first two codons at the 5' end; and a residue at position 8 and 9 containing the native amino acid sequence of BLS An AflII site in the two codons.
[0099] b) In order to insert the encoded sequence into the Stx2B protein (SEQ.ID.No.1), we designed an oligonucleotide to amplify the Stx...
Embodiment 3
[0109] The pCI-neo-BLS-Stx2B-L5 plasmid was constructed by the following protocol:
[0110] The gene sequence Seq. ID. No. 4 of BLS-Stx2B (L5) cloned in the pET11a vector was subcloned into the vector pCi-neo (Promega, USA). Therefore, the following oligonucleotides were prepared to be used as primers in PCR: ACCATG
[0111] BLS-DNA-chimera all (Seq.ID.No.12): 5'GTTTAAGAATTCGAAGGAGAT ACCACCATG CAT3′
[0113] Primer BLS-DNA-chimera all added restriction site for EcoRI enzyme (bold) and Kozak consensus sequence (underlined); BLS-Back primer added restriction site for NheI enzyme (bold) .
[0114] Such sequences were amplified by PCR using the pET11a-BLS-Stx2B(L5) plasmid as a template. PCR reactions were performed as described in Example 2C. The cycling pattern was: 94°C for 5 minutes, 1 cycle; 94°C for 1 minute, 55°C for 1 minute and 74°C for 1 minute, 40 cycles; and 74°C for 8 minutes, 1 final c...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The present invention relates to chimeric polypeptides useful as immunogens for inducing protective immune responses and neutralizing antibodies against Shiga toxin (Stx) in mammals. More specifically, the present invention relates to chimeric polypeptides comprising a monomer of the homopentameric B subunit of the Shiga 2 toxin fused to the N-terminus of a monomer of Brucella lumazine synthase, and to oligomeric protein complexes formed from said chimeric polypeptides. The invention further relates to polynucleotides and vectors encoding said chimeric polypeptides, to transgenic cells comprising said polynucleotides and vectors, and to pharmaceutical compositions, such as a vaccine, comprising said chimeric polypeptides and chimeric polynucleotides. Also within the scope of the invention are antibodies which bind to the chimeric polypeptides of the invention, a method for obtaining antibodies which bind specifically to the subunit B of the Shiga 2 toxin and methods of lowering the bacterial load of enterohemorrhagic Escherichia coli in mammals, which can be used for prevention of inter alia, hemolytic-ureic syndrome (HUS).
Description
technical field [0001] The present invention relates to chimeric polypeptides useful as immunogens for inducing protective immune responses against Shigatoxin (Stx) and neutralizing antibodies in mammals. Specifically, the present invention relates to chimeric polypeptides and oligomeric protein complexes formed by said chimeric polypeptides, said chimeric polypeptides comprising and Brucella (Brucella) 2,4-dioxotetrahydropteridine Monomer of the homopentameric B subunit of Shiga 2 toxin fused to the N-terminus of the monomer of lumazine synthase. The present invention also relates to polynucleotides and vectors encoding said chimeric polypeptides, transgenic cells comprising said polynucleotides and vectors, and pharmaceutical compositions (such as vaccines) comprising said chimeric polypeptides and chimeric polynucleotides . Antibodies that bind chimeric polypeptides of the invention, methods for obtaining antibodies that specifically bind to the B subunit of Shiga 2 toxin...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.