A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei

A technology for Acinetobacter ruckeri and fluorescence quantification, applied in the field of bioengineering, can solve the problems of cumbersome medium separation and identification methods, deviation of food contamination degree, false positives, etc., achieve short detection time, ensure food safety, and specificity strong effect

Active Publication Date: 2021-03-12
YANGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the medium separation and identification method is very cumbersome in actual operation, and is easily contaminated by bacteria in the environment: compared with the traditional separation and identification detection method, the common PCR method is more sensitive and faster, but it is not effective for Acinetobacter ruckeri The requirements for the content of bacteria liquid and the number of miscellaneous bacteria are relatively strict, and there may be false positive and false negative results, which will cause deviations in the degree of contamination of the screened food.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei
  • A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei
  • A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1. Design and synthesis of primers:

[0048] By comparing the genome sequences of Acinetobacter ruckeri and its related species, such as Acinetobacter baumannii, Acinetobacter schindleri, Acinetobacter haemolyticus, etc., to find out The interspecies-specific sequence of Acinetobacter ruckeri, and then BLASTed the sequence to analyze its homology with non-Acinetobacter microorganisms, and finally determined that the β-lactamase gene of the OXA134 family was not Specific conserved gene sequences of A. Based on this gene design specific primers for analysis.

[0049] When designing primers, firstly, according to the β-lactamase amino acid sequence of A.lwoffii ATCC1530 (GenBank: WP_004728961), compare various Acinetobacter ruckerii in the database, A.lwoffii strain St17095 (GenBank: AHA11126.1), A.lwoffii AL3 (GenBank: ADM47435.1) and A.lwoffii strain S459 (GenBank: ALM26450.1), find out the conserved sequence segment between species; then perform DNAMAN software homolo...

Embodiment 2

[0063] In Example 2, the real-time fluorescent quantitative PCR method for detecting Acinetobacter ruckeri provided by the present invention is used to detect raw milk sampled from 8 dairy farms in Yangzhou City, Jiangsu Province in different months (November, December, January, February) , to determine whether the raw milk of each pasture is contaminated with Acinetobacter ruckeri (A.lwoffii), so as to monitor the quality of milk source of each pasture.

[0064] The specific method is as follows:

[0065] (1) Extract the DNA in the raw milk sample to be tested:

[0066] Take 1mL of raw milk, centrifuge at 12000g / min for 5min, discard the upper layer of fat, wash twice with sterile saline, centrifuge at 12000g / min for 2min, and then use the patent "method for extracting total DNA from milk" (patent application number: 200810115822.9) The method for extracting the DNA in the lower layer of the pellet.

[0067] (2) using the DNA extracted in step (1) as a template, amplifying ...

Embodiment 3

[0073] In Example 3, the sensitivity of the fluorescent quantitative PCR detection method of the present invention and conventional PCR was compared.

[0074] With the genomic DNA of different concentrations of bacterial liquid obtained in step 4) of Example 1 as a template, AL-F and AL-R are primers for conventional PCR amplification. The reaction conditions are: 95°C for 3min, 30 cycles (95°C 30s, 55°C 30s, 72°C 30s), 72°C 10min. Depend on Figure 4 It can be seen that the sensitivity of conventional PCR detection of A.lwoffii is 2.4×10 3 cfu / mL; compare it with image 3 The minimum number of colonies (2.4 × 10) detected by the fluorescent quantitative PCR of the present invention shown 2 cfu / mL), the sensitivity of the present invention is significantly higher than that of ordinary PCR detection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescent quantitative PCR detection primer and method for Acinetobacter ruckeri. The nucleotide sequences of the primers are respectively: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method includes: 1) extracting the DNA of the sample to be tested; 2) using the DNA as a template, using the above primers, and using the fluorescent quantitative PCR method to amplify Acinetobacter ruckeri , and the fluorescence value Ct was collected during the annealing stage at 55°C 样品 value; 3) according to the model bacteria concentration is ×10 2 ,×10 3 ,×10 4 ,×10 5 ,×10 6 ,×10 7 When the corresponding Ct 标准 Value, establish the bacteria number lg of Acinetobacter ruckeri 标准 with Ct 标准 A standard curve of values, and according to Ct 样品 value, the number of Acinetobacter ruckeri in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and its detection limit can reach ×10 2 cfu / mL, the detection method is fast, accurate, and time-consuming.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a real-time fluorescence quantitative PCR detection method for Acinetobacter ruckeri. Background technique [0002] Acinetobacter lwoffii widely exists in nature, mainly in water and soil, and can also be detected in milk, dairy products, poultry and frozen food. Acinetobacter ruckeri is an important opportunistic pathogen, often causing sepsis, pneumonia, endocarditis, etc. [1] , in addition, Acinetobacter ruckeri can produce heat-resistant protease and lipase to destroy food ingredients, heat sterilization can destroy Acinetobacter ruckeri, but the activity of these heat-resistant enzymes is basically not affected, even after ultra-high temperature sterilization They will continue to decompose protein and fat during food storage, which will lead to changes in the product and eventually have an adverse effect on food quality: (1) Decomposing milk protein by p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6851C12Q1/689C12Q2563/107C12Q2531/113
Inventor张慧敏樊永亮夏海磊喻佩毛永江杨章平
OwnerYANGZHOU UNIV