52 results about "Acinetobacter lwoffii" patented technology

The invention discloses a turbot pathogenic strain which is Acinetobacter lwoffii, wherein the collection number of the strain is CCTCC (China center for type culture collection) M2010372. The screened Acinetobacter lwoffii is used for preparing an inactivated vaccine. In addition, the Acinetobacter lwoffii, tetraodotoxin pseudoalteromonas and pseudomonas are used for preparing a bigeminy or trigeminy inactivated vaccine which is used for immunizing the turbot ascites disease. The preparation process of the inactivated vaccine for the ascites disease is simple, the yield is stable, the cost is low, and a large amount of inactivated vaccines with high immune effect can be obtained. The immune protective rate of the inactivated vaccine prepared by the method can reach 70%. The vaccine is a pure biological agent, has the characteristics of safety and environment friendliness, and dose not causes medicament residues and environment pollution; and by using the method, the generation and popularization of the turbot ascites disease are fundamentally suppressed, and a technical support is provided for preparing the novel inactivated vaccine for the turbot ascites disease.

The invention provides an application of amomum tsao-ko oil in preparation of drugs for treating bacterial infectious diseases. The bacteria may be coagulase negative staphylococci, kurthia gibsonii, megacoccus, corynebacterium, enterococcus faecalis, bacillus, escherichia coli, monad, acinetobacter lwoffii, flavobacterium indologenes, enterobacter cloacae, flexneri or common mycetozoan. The drugs mentioned in the invention have antimicrobial activity to gram-positive bacterium and gram-negative bacterium, also have high bacteriostatic action to persister therein and simultaneously have good antibacterial action in body, so the drugs can effectively treat infectious diseases caused by various strains in gram-positive bacterium and gram-negative bacterium, therefore the invention provides a new drug use option for clinic.

The present invention relates to a composite flora for biological preparation of a cellulose additive, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and pseudomonas fluorescens with a preservation number of CGMCC No.5974. The process for preparing additive cellulose comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises fiber kneading or squeezing rolling, biodegradation, steam sterilization, fiber obtaining, sterilization and grinding. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.

The invention discloses Acinetobacter ruckeri, which is Acinetobacter lwoffii JX-2 with the preservation number: CGMCC No. 13144 preserved by the General Microorganism Center of China Microbiological Culture Collection Management Committee. Acinetobacter lwoffii JX-2, whose preservation number is CGMCC No.13144, can effectively degrade pyrethroid pesticides, can be used for bioremediation or biopurification of polluted soil and water bodies, protects the ecological environment, and has excellent application prospects .

The invention provides a fluorescent quantitative PCR detection primer and method for Acinetobacter ruckeri. The nucleotide sequences of the primers are respectively: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method includes: 1) extracting the DNA of the sample to be tested; 2) using the DNA as a template, using the above primers, and using the fluorescent quantitative PCR method to amplify Acinetobacter ruckeri , and the fluorescence value Ct was collected during the annealing stage at 55°C 样品 value; 3) according to the model bacteria concentration is ×10 2 ,×10 3 ,×10 4 ,×10 5 ,×10 6 ,×10 7 When the corresponding Ct 标准 Value, establish the bacteria number lg of Acinetobacter ruckeri 标准 with Ct 标准 A standard curve of values, and according to Ct 样品 value, the number of Acinetobacter ruckeri in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and its detection limit can reach ×10 2 cfu / mL, the detection method is fast, accurate, and time-consuming.

The invention relates to biological flora and a biological bacterium liquid pulping method. The composite flora comprises bacillus sp. with the collection number CGMCC No.5971, rheineheimera tangshanensis with the collection umber CGMCC No.5972, acinetobacter lwoffii with the collection number CGMCC No.5973, pseudomonas fluorescens with collection number CGMCC No.5974, and Wickerhamonmyces anomalus with the collection number CGMCC No.5975. The method mainly comprises the following steps of: preparing bacterium-containing liquid; treating raw materials; and pulping, namely defibering, performing biodegradation, performing steam sterilization, coarsely grinding to obtain pulp, finely grinding to obtain pulp, screening pulp materials, performing latency and washing pulp. A paperboard which is prepared by the biological bacterium liquid pulping method can reach above the AA level. Waste liquid produced in the pulping process can be recycled or converted into methane or organic manure which is used as energy resources. Energy resources are saved, and the method is environment-friendly.