Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

52 results about "Acinetobacter lwoffii" patented technology

Acinetobacter lwoffii, formerly known as Mima polymorpha or Acinetobacter calcoaceticus var. lwoffii, is a non-fermentative Gram-negative bacillus bacterium that is a member of the genus Acinetobacter. It is considered normal skin flora and can also inhabit the human oropharynx and perineum of up to 25% of the population. It can cause infections in human hosts, particularly catheter-associated infections in immunocompromised patients. It has also been associated with at least one case of gastroenteritis. Due to its ability to survive dry conditions, low pH, and a wide range of temperatures, A. lwoffii, along with A. johnsonni, has been found in frozen food, bacon, eggs, pasteurized milk, and fish. It is also resistant to many disinfectants, irradiation, and desiccation.

Turbot pathogenic strain and inactivated vaccine for ascites disease

The invention discloses a turbot pathogenic strain which is Acinetobacter lwoffii, wherein the collection number of the strain is CCTCC (China center for type culture collection) NO:M2010372. The screened Acinetobacter lwoffii is used for preparing an inactivated vaccine. In addition, the Acinetobacter lwoffii, tetraodotoxin pseudoalteromonas and pseudomonas are used for preparing a bigeminy or trigeminy inactivated vaccine which is used for immunizing the turbot ascites disease. The preparation process of the inactivated vaccine for the ascites disease is simple, the yield is stable, the cost is low, and a large amount of inactivated vaccines with high immune effect can be obtained. The immune protective rate of the inactivated vaccine prepared by the method can reach 70%. The vaccine is a pure biological agent, has the characteristics of safety and environment friendliness, and dose not causes medicament residues and environment pollution; and by using the method, the generation and popularization of the turbot ascites disease are fundamentally suppressed, and a technical support is provided for preparing the novel inactivated vaccine for the turbot ascites disease.
Owner:THE FIRST INST OF OCEANOGRAPHY SOA

Composite microbial preparation for treating domestic sewage and preparation method thereof

The invention belongs to the field of microbial preparations, and in particular relates to a composite microbial preparation for treating domestic sewage and a preparation method thereof. The composite microbial preparation for treating the domestic sewage comprises rhodopseudomonas palustris ACCC10649, saccharomyces cerevisiae ACCC20251, lactobacillus acidophilus ACCC11073, bacillus subtilis ACCC10619, pseudomonas nitroreducens ACCC04184, acinetobacter lwoffii ACCC01091 and candida tropicalis ACCC20004. According to the composite microbial preparation for treating the domestic sewage and the preparation method thereof, which are provided by the invention, organic matters in the sewage are converted into simple inorganic matters through decomposition of microorganisms, so that the sewage is treated effectively.
Owner:深圳科鹏境美环保科技有限公司

Method for quickly identifying bloodstream infection pathogenic bacteria

The invention belongs to the field of examination of microorganisms, and relates to a method for quickly identifying bloodstream infection bacteria by a high-resolution fusion curve method. The method comprises the following steps of: performing smear gram staining on a blood culture positive culture flask to distinguish negative bacteria and positive bacteria; selectively amplifying different 16S fragments for the negative bacteria and the positive bacteria; and analyzing by the high-resolution fusion curve method. Common bloodstream infection pathogenic bacteria comprise staphylococcus aureus, staphylococcus epidermidis, enterococcus faecalis, enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, acinetobacter baumannii, pseudomonas aeruginosa, enterobacter cloacae, Serratia marcescens, Klebsiella oxytoca, acinetobacter lwoffii, enterobacter aerogenes, stenotrophomonas maltophilia and burkholderia cepacia. By the method, the common bloodstream infection pathogenic bacteria can be measured quickly, efficiently and accurately, so that strong evidences are provided and precious time is striven for subsequent treatment.
Owner:AFFILIATED HUSN HOSPITAL OF FUDAN UNIV +1

Livestock manure biodegradation mixed culture, carrier and method

The invention discloses a livestock manure biodegradation mixed culture, a carrier and a method. The mixed culture mainly comprises bacillus subtilis, bacillus pumilus, bacillus cereus, bacillus licheniformis, acinetobacter lwoffii and alcaligenes faecalis, and is yellow liquid, a bacterial spawn is obtained by mixing and crushing the carrier and the mixed culture, the mixed culture and the livestock manure are mixed for degradation, and a small number of generated residues can be used as organic fertilizer in greening. The livestock manure biodegradation mixed culture, the carrier and the method have the advantages that the livestock manure is emission-free, pollution-free and odourless, the livestock manure biodegradation contains natural antibiotics, the immunity of the livestock can beimproved, constant temperature and stable fermentation can be maintained; a livestock manure biodegradation device or equipment can save land resources, the cost of construction of livestock breeding, labor, energy and the like, the device and the equipment are combined on the basis of the corresponding purposes of the work to achieve the goal of disposing organic matter or degrading organic matter.
Owner:SUZHOU DINGYU ENERGY EFFICIENT EQUIP

Detection primers of acinetobacter lwoffii and fluorescent quantitative PCR detection method

The invention provides fluorescent quantitative PCR detection primers and method of acinetobacter lwoffii. The primers have the nucleotide sequences of TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA. The detection method includes the steps of firstly, extracting DNA of a to-be-detected sample; secondly, amplifying acinetobacter lwoffii by means of the fluorescent quantitative PCR method through the primers with the DNA as the template, and collecting fluorescent value Ct sample values at the annealing stage of 55 DEG C; thirdly, establishing a standard curve of bacteria number 1g standard and Ct standard values of acinetobacter lwoffii according to the Ct standard values corresponding to model bacteria concentrations of *102, *103, *104, *105, *106 and *107, and determining the number of acinetobacter lwoffii in the sample on the standard curve according to the Ct sample values. The primers are high in specificity and sensitivity, the detection limitation of the primers can reach *102 cfu / mL, and the detection method is rapid, accurate and short in consumed time.
Owner:YANGZHOU UNIV

Bacteria and its application in absorbing VOCs

The invention discloses a bacteria; the bacteria is prepared from, by weight, 32-56 parts of sarcina, 15-34 parts of spirillum, 20-35 parts of Brevibacillus laterosporus, 23-62 parts of Acinetobacter lwoffii, and 36-68 parts of Chryseobacterium indologenes. When the bacteria is applied to treat the VOCs waste gas, the treatment effect to VOCs is good, and the degrading efficiency is high.
Owner:SCI RES ACADEMY OF GUANGXI ENVIRONMENTAL PROTECTION

Method for increasing yield of bacterium curdlan by using acinetobacter

ActiveCN104894205AIncrease rubber productionMicroorganism based processesFermentationMicroorganismBacteroides
The invention relates to a method for increasing the yield of bacterium curdlan by using acinetobacter. The method comprises the step of co-culturing acinetobacter lwoffii and curdlan producing bacteria to obtain the bacterium curdlan. By using the method disclosed by the invention, the yield of the curdlan producing bacteria is increased, and a novel method for producing curdlan through microbial fermentation is provided.
Owner:DONGHUA UNIV +1

Turbot pathogenic strain and inactivated vaccine for ascites disease

The invention discloses a turbot pathogenic strain which is Acinetobacter lwoffii, wherein the collection number of the strain is CCTCC (China center for type culture collection) M2010372. The screened Acinetobacter lwoffii is used for preparing an inactivated vaccine. In addition, the Acinetobacter lwoffii, tetraodotoxin pseudoalteromonas and pseudomonas are used for preparing a bigeminy or trigeminy inactivated vaccine which is used for immunizing the turbot ascites disease. The preparation process of the inactivated vaccine for the ascites disease is simple, the yield is stable, the cost is low, and a large amount of inactivated vaccines with high immune effect can be obtained. The immune protective rate of the inactivated vaccine prepared by the method can reach 70%. The vaccine is a pure biological agent, has the characteristics of safety and environment friendliness, and dose not causes medicament residues and environment pollution; and by using the method, the generation and popularization of the turbot ascites disease are fundamentally suppressed, and a technical support is provided for preparing the novel inactivated vaccine for the turbot ascites disease.
Owner:THE FIRST INST OF OCEANOGRAPHY SOA

Compound bacteria and method for preparing textile fiber using same

The invention relates to compound bacteria and a method for preparing textile fiber using the compound bacteria. The compound bacteria comprise bacillus stored with a number of CGMCC No. 5971, acinetobacter lwoffii stored with a number of CGMCC No. 5973, pseudomonas fluorescens stored with a number of CGMCC No. 5974, and Wickerhamomyces anomalus stored with a number of CGMCC No. 5975. The method comprises the following steps of: preparing bacteria liquid; processing raw materials; and preparing fibers, wherein fiber preparing steps comprise the following steps of: carrying out biodegradation, sterilizing through steam, and obtaining the fibers; drying; and carding. The method provided by the invention is environment-friendly; waste liquid is directly transformed into organic fertilizer, therefore, zero emission and zero pollution are achieved. A biological treating process performs protection to the fibers. Compared with a traditional chemical method, the method provided by the invention has the advantages of being low in producing cost, high in economic benefit, and is capable of saving an energy resource and protecting an environment.
Owner:BEIJING TIANAN BIOSCI & TECH

Biological flora and biological bacterium liquid pulping method

The invention relates to biological flora and a biological bacterium liquid pulping method. The composite flora comprises bacillus sp. with the collection number CGMCC No.5971, rheineheimera tangshanensis with the collection umber CGMCC No.5972, acinetobacter lwoffii with the collection number CGMCC No.5973, pseudomonas fluorescens with collection number CGMCC No.5974, and Wickerhamonmyces anomalus with the collection number CGMCC No.5975. The method mainly comprises the following steps of: preparing bacterium-containing liquid; treating raw materials; and pulping, namely defibering, performing biodegradation, performing steam sterilization, coarsely grinding to obtain pulp, finely grinding to obtain pulp, screening pulp materials, performing latency and washing pulp. A paperboard which is prepared by the biological bacterium liquid pulping method can reach above the AA level. Waste liquid produced in the pulping process can be recycled or converted into methane or organic manure which is used as energy resources. Energy resources are saved, and the method is environment-friendly.
Owner:BEIJING TIANAN BIOSCI & TECH

Acinetobacter lwoffii and biological bacteria liquid pulping method thereof

The invention relates to acinetobacter lwoffii and a biological bacteria liquid pulping method of the acinetobacter lwoffii. The acinetobacter lwoffii is stored with a number of CGMCC No. 5973. The biological bacteria liquid pulping method mainly comprises the following steps of: preparing bacteria liquid; processing raw materials; and pulping, wherein pulping steps comprise the following steps of: degrading, biologically degrading, sterilizing through steam, carrying out rough pulping, carrying out fine pulping, screening a sizing agent, removing latency, and washing the sizing agent. A paperboard prepared by the biological bacteria liquid pulping method provided by the invention reaches a level over AA grade; waste liquid produced in a pulping process can be recycled or transformed into methane which can be served as an energy resource or organic fertilizer, and therefore, energy resources are saved, and environment protection is achieved.
Owner:BEIJING TIANAN BIOSCI & TECH

Application of amomum tsao-ko oil in preparation of drugs for treating bacterial infectious diseases

The invention provides an application of amomum tsao-ko oil in preparation of drugs for treating bacterial infectious diseases. The bacteria may be coagulase negative staphylococci, kurthia gibsonii, megacoccus, corynebacterium, enterococcus faecalis, bacillus, escherichia coli, monad, acinetobacter lwoffii, flavobacterium indologenes, enterobacter cloacae, flexneri or common mycetozoan. The drugs mentioned in the invention have antimicrobial activity to gram-positive bacterium and gram-negative bacterium, also have high bacteriostatic action to persister therein and simultaneously have good antibacterial action in body, so the drugs can effectively treat infectious diseases caused by various strains in gram-positive bacterium and gram-negative bacterium, therefore the invention provides a new drug use option for clinic.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

Acinetobacter lwoffii and method for preparing textile fibers by using same

The invention relates to acinetobacter lwoffii and a method for preparing textile fibers by using the same. The collection number of the acinetobacter lwoffii is CGMCC No.5973. The method comprises the following steps of: preparing a bacterial solution; processing raw material; and preparing fibers, namely biodegradation, steam sterilization, fiber collection, drying and carding. The method disclosed by the invention is completely environment-friendly, because all waste liquid can be directly converted into organic fertilizers. In a biological treatment process, fibers are protected. Compared with the conventional chemical methods, the method has the advantages that the production cost is low, the economic benefit is high, energy can be saved and pollution is avoided.
Owner:BEIJING TIANAN BIOSCI & TECH

Compound bacteria, compound bacterial agent containing same, preparation method of compound bacterial agent containing same, and application of compound bacteria and compound bacterial agent containing same

InactiveCN108220181ANo pollutionRemarkable effect on degrading ligninFungiBacteriaMicrobiologyChrysosporium species
The invention provides compound bacteria, a compound bacterial agent containing the same, a preparation method of the compound bacterial agent containing the same, and application of the compound bacteria and the compound bacterial agent containing the same. The compound bacteria comprise acinetobacter lwoffii with the preservation number of CGMCC No.5973, wickerhamomyces anomalus with the preservation number of CGMCC No.5975, phanerochaete chrysosporium and pleurotus ostreatus; through synergistic interaction of various bacteria in the compound bacteria, the compound bacteria have a remarkable effect in the aspect of degrading lignin, particularly the lignin in a hemp rod; the problems of overlong time in bio-pulping, low fibre degree and low yield in the prior art are solved; remarkabletechnical effects of high fibre degree, high yield, short working hours, low cost and no environmental pollution are achieved.
Owner:康盛时代(北京)生物技术有限公司

Bacterial synthetic community and application thereof in preparation of biological control agent for controlling postharvest diseases of citrus fruits

PendingCN112695002AThe effect of early onset is obviousThe effect of disease control is weakenedFruit and vegetables preservationBacteriaBiotechnologyCitrus volkameriana
The invention discloses a bacterial synthetic community, which is composed of eight bacteria, namely Acinetobacter lwoffii, Bacillus amyloliquefaciens, Curptobacterium luteum, Curptobacterium sp., Methylobacterium platani, Pantoea sp., Pseudomonas parasulva and Pseudomonas sp., compared with a single bacterial strain, the bacterial synthetic community can better control the occurrence and progress of citrus green mold and sour rot, can more enduringly control diseases, can be used for preparing a biological control agent for controlling postharvest diseases of citrus fruits, has good application potential. A new thought and method are provided for controlling the postharvest diseases of the citrus fruits, and the application range of the bacterial synthetic community is widened.
Owner:SOUTHWEST UNIVERSITY

Acinetobacter lwoffii and method for preparing cellulose for additive using same

The invention relates to acinetobacter lwoffii and a method for preparing cellulose for an additive using the acinetobacter lwoffii. The acinetobacter lwoffii is stored with a number of CGMCC No. 5973. The method comprises the following steps of: preparing bacteria liquid; processing raw materials; and preparing fibers, wherein fiber preparing steps comprise the following steps of: defibering, biologically degrading, sterilizing through steam, and obtaining the fibers, sterilizing and grinding. The method provided by the invention is environment-friendly; waste liquid is directly transformed into organic fertilizer, therefore, zero emission and zero pollution are achieved. A biological treating process performs protection to the fibers. Compared with a traditional chemical method, the method provided by the invention has the advantages of being low in producing cost, high in economic benefit, and is capable of saving an energy resource and protecting an environment.
Owner:BEIJING TIANAN BIOSCI & TECH

Compound bacteria for biological bacteria liquid pulping and application of compound bacteria

The invention relates to compound bacteria for biological bacteria liquid pulping and application of the compound bacteria. The invention also provides a biological bacteria liquid pulping method. The compound bacteria comprise bacillus stored with a number of CGMCC No. 5971, acinetobacter lwoffii stored with a number of CGMCC No. 5973, and Wickerhamomyces anomalus stored with a number of CGMCC No. 5975. The method mainly comprises the following steps of: preparing bacteria liquid; processing raw materials; and pulping, wherein pulping steps comprise the following steps of: defibering, biologically degrading, sterilizing through steam, carrying out rough pulping, carrying out fine pulping, screening a sizing agent, removing latency, and washing the sizing agent. A paperboard prepared by the biological bacteria liquid pulping method provided by the invention reaches a level over AA grade; waste liquid produced in a pulping process can be recycled or transformed into methane which can be served as an energy resource or organic fertilizer, and therefore, energy sources are saved, and environment protection is achieved.
Owner:BEIJING TIANAN BIOSCI & TECH

Application of Amomum tsao-ko oil to preparation of medicament for treating bacterial infectious disease

The invention provides application of Amomum tsao-ko oil to preparation of medicaments for treating bacterial infectious diseases. The bacteria is coagulase negative staphylococcus, Kurthia gibsonii, megacoccus, corynebacterium, enterococcus faecalis, bacillus, escherichia coli, Pseudomonas, Acinetobacter lwoffii, Chryseobacterium indologenes, Enterobacter cloacae, S.flexneri or proteus vulgaris. The medicine provided by the invention has antibacterial activity against gram positive bacteria and gram negative bacteria, as well as strong inhibitory effect on the resistant strains, and also has good antibacterial effect in vivo; in addition; and the medicament can effectively treat clinical infectious diseases caused by gram positive and gram negative bacteria of various types, and provides a novel clinical medicine choice.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

Compound bacterium used for pulping biological bacterium fluid and application of compound bacterium

The invention relates to a compound bacterium used for pulping a biological bacterium fluid and the application of the compound bacterium. The invention further provides a method for pulping the biological bacterium fluid. The compound bacterium comprises bacillus (CGMCC No.5971), acinetobacter lwoffii (CGMCC No.5973) and pseudomonas fluorescens (CGMCC No.5974). The method mainly comprises the steps as follows: preparing the bacterium fluid; handling raw materials; and pulping which comprises defibering, bio-degradation, steam sterilization, rough pulping, fine pulping, pulp screening, latency and pulp washing. Paperboards prepared by the method for pulping the biological bacterium fluid reach or exceed AA levels. Waste liquid generated in the pulping process can be recycled or translated into methane which can be used as energy resources or organic fertilizers. The method has the advantages of energy conservation and environmental protection.
Owner:BEIJING TIANAN BIOSCI & TECH

Mixed bacteria and use thereof in cellulose used for preparing additives

The invention relates to mixed bacteria and use thereof in cellulose used for preparing additives. The mixed bacteria comprise acinetobacter lwoffii with a collection number of CGMCC No.5973, pseudomonas fluorescens with a collection number of CGMCC No.5974, and wickerhamomyces anomalus with a collection number of CGMCC No.5975. A process for preparing the cellulose used for preparing additives comprises the following steps of: preparing a bacterial solution; processing raw materials; preparing fibers by defibering, biodegradation, steam sterilization and fiber collection; and sterilizing, and grinding. The method is environment-friendly, because waste liquid is changed into organic fertilizers directly rather than being discharged. In the biological treatment process, the fibers are protected. Compared with the conventional chemical methods, the process has the advantages that the production cost is low, the economic benefit is high, energy can be saved and pollution is avoided.
Owner:BEIJING TIANAN BIOSCI & TECH

Composite flora and pulping method by using biological bacterial liquid of composite flora

The present invention relates to a composite flora and a pulping method by using a biological bacterial liquid of the composite flora. The composite flora comprises acinetobacter lwoffii with a preservation number of CGMCC No.5973, pseudomonas fluorescens with a preservation number of CGMCC No.5974, and Wickerhamomyces anomalus with a preservation number of CGMCC No.5975. The method mainly comprises: preparing a bacterial liquid; treating raw materials; and pulping, wherein pulping comprises: fiber kneading or squeezing rolling, biodegradation, steam sterilization, crude pulp grinding, fine pulp grinding, pulp material screening, soaking, and pulp washing. The paper board prepared by using the pulping method can achieve a level of more than an AA grade. In addition, waste liquid generated during a pulping process can be recycled or converted into biogas or an organic fertilizer adopted as an energy source so as to provide advantages of energy source saving and environment protection.
Owner:BEIJING TIANAN BIOSCI & TECH

Composite flora for biological preparation of textile fibers, and applications thereof

The present invention relates to a composite flora for biological preparation of textile fibers, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and pseudomonas fluorescens with a preservation number of CGMCC No.5974. The method comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises biodegradation, steam sterilization, fiber obtaining, drying, and combing. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.
Owner:BEIJING TIANAN BIOSCI & TECH

Microbial degradation material for flushing-free ecological closestool and preparation method of microbial degradation material

The invention discloses a microbial degradation material for a flushing-free closestool and a preparation method of the microbial degradation material, and belongs to the technical field of microorganisms. The microbial degradation material comprises a biological agent and a carrier, wherein biological agent is composed of bacillus subtilis, candida utilis, aspergillus oryzae, pediococcus acidilactici, lactobacillus acidophilus, bacillus pumilus, bacillus cereus, bacillus licheniformis, acinetobacter lwoffii and alcaligenes faecalis, and the volume fractions of the carrier and the biological agent are 85% and 15% respectively. According to the microbial degradation material for the flushing-free closestool, the microbial agent is reasonable in formula and convenient to use, excrement can be efficiently fermented, the excrement is decomposed and synthesized into protein of microorganisms, secondary pollution cannot be caused in the decomposition process, and emission of odorous gas suchas ammonia and nitrogen and the like in an animal farm is effectively reduced.
Owner:东莞市条形智能科技有限公司

Composite flora for biological preparation of textile fibers, and applications thereof

The present invention relates to a composite flora for biological preparation of textile fibers, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and Wickerhamomyces anomalus with a preservation number of CGMCC No.5975. The method comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises biodegradation, steam sterilization, fiber obtaining, drying, and combing. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.
Owner:BEIJING TIANAN BIOSCI & TECH

Composite flora for biological preparation of cellulose additive, and applications thereof

The present invention relates to a composite flora for biological preparation of a cellulose additive, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and pseudomonas fluorescens with a preservation number of CGMCC No.5974. The process for preparing additive cellulose comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises fiber kneading or squeezing rolling, biodegradation, steam sterilization, fiber obtaining, sterilization and grinding. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.
Owner:BEIJING TIANAN BIOSCI & TECH

Composite flora for biological preparation of textile fibers, and applications thereof

The present invention relates to a composite flora for biological preparation of textile fibers, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and Wickerhamomyces anomalus with a preservation number of CGMCC No.5975. The method comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises biodegradation, steam sterilization, fiber obtaining, drying, and combing. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.
Owner:BEIJING TIANAN BIOSCI & TECH

A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei

The invention provides a fluorescent quantitative PCR detection primer and method for Acinetobacter ruckeri. The nucleotide sequences of the primers are respectively: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method includes: 1) extracting the DNA of the sample to be tested; 2) using the DNA as a template, using the above primers, and using the fluorescent quantitative PCR method to amplify Acinetobacter ruckeri , and the fluorescence value Ct was collected during the annealing stage at 55°C 样品 value; 3) according to the model bacteria concentration is ×10 2 ,×10 3 ,×10 4 ,×10 5 ,×10 6 ,×10 7 When the corresponding Ct 标准 Value, establish the bacteria number lg of Acinetobacter ruckeri 标准 with Ct 标准 A standard curve of values, and according to Ct 样品 value, the number of Acinetobacter ruckeri in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and its detection limit can reach ×10 2 cfu / mL, the detection method is fast, accurate, and time-consuming.
Owner:YANGZHOU UNIV

Biological flora and biological bacterial liquid pulping method

The invention relates to biological flora and a biological bacterium liquid pulping method. The composite flora comprises bacillus sp. with the collection number CGMCC No.5971, rheineheimera tangshanensis with the collection umber CGMCC No.5972, acinetobacter lwoffii with the collection number CGMCC No.5973, pseudomonas fluorescens with collection number CGMCC No.5974, and Wickerhamonmyces anomalus with the collection number CGMCC No.5975. The method mainly comprises the following steps of: preparing bacterium-containing liquid; treating raw materials; and pulping, namely defibering, performing biodegradation, performing steam sterilization, coarsely grinding to obtain pulp, finely grinding to obtain pulp, screening pulp materials, performing latency and washing pulp. A paperboard which is prepared by the biological bacterium liquid pulping method can reach above the AA level. Waste liquid produced in the pulping process can be recycled or converted into methane or organic manure which is used as energy resources. Energy resources are saved, and the method is environment-friendly.
Owner:BEIJING TIANAN BIOSCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More