52 results about "Acinetobacter lwoffii" patented technology

The invention discloses a turbot pathogenic strain which is Acinetobacter lwoffii, wherein the collection number of the strain is CCTCC (China center for type culture collection) NO:M2010372. The screened Acinetobacter lwoffii is used for preparing an inactivated vaccine. In addition, the Acinetobacter lwoffii, tetraodotoxin pseudoalteromonas and pseudomonas are used for preparing a bigeminy or trigeminy inactivated vaccine which is used for immunizing the turbot ascites disease. The preparation process of the inactivated vaccine for the ascites disease is simple, the yield is stable, the cost is low, and a large amount of inactivated vaccines with high immune effect can be obtained. The immune protective rate of the inactivated vaccine prepared by the method can reach 70%. The vaccine is a pure biological agent, has the characteristics of safety and environment friendliness, and dose not causes medicament residues and environment pollution; and by using the method, the generation and popularization of the turbot ascites disease are fundamentally suppressed, and a technical support is provided for preparing the novel inactivated vaccine for the turbot ascites disease.

The invention belongs to the field of examination of microorganisms, and relates to a method for quickly identifying bloodstream infection bacteria by a high-resolution fusion curve method. The method comprises the following steps of: performing smear gram staining on a blood culture positive culture flask to distinguish negative bacteria and positive bacteria; selectively amplifying different 16S fragments for the negative bacteria and the positive bacteria; and analyzing by the high-resolution fusion curve method. Common bloodstream infection pathogenic bacteria comprise staphylococcus aureus, staphylococcus epidermidis, enterococcus faecalis, enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, acinetobacter baumannii, pseudomonas aeruginosa, enterobacter cloacae, Serratia marcescens, Klebsiella oxytoca, acinetobacter lwoffii, enterobacter aerogenes, stenotrophomonas maltophilia and burkholderia cepacia. By the method, the common bloodstream infection pathogenic bacteria can be measured quickly, efficiently and accurately, so that strong evidences are provided and precious time is striven for subsequent treatment.

The invention discloses a livestock manure biodegradation mixed culture, a carrier and a method. The mixed culture mainly comprises bacillus subtilis, bacillus pumilus, bacillus cereus, bacillus licheniformis, acinetobacter lwoffii and alcaligenes faecalis, and is yellow liquid, a bacterial spawn is obtained by mixing and crushing the carrier and the mixed culture, the mixed culture and the livestock manure are mixed for degradation, and a small number of generated residues can be used as organic fertilizer in greening. The livestock manure biodegradation mixed culture, the carrier and the method have the advantages that the livestock manure is emission-free, pollution-free and odourless, the livestock manure biodegradation contains natural antibiotics, the immunity of the livestock can beimproved, constant temperature and stable fermentation can be maintained; a livestock manure biodegradation device or equipment can save land resources, the cost of construction of livestock breeding, labor, energy and the like, the device and the equipment are combined on the basis of the corresponding purposes of the work to achieve the goal of disposing organic matter or degrading organic matter.

The invention discloses a post-neurosurgical intracranial bacterial infection common pathogenic bacterium MLPA detection probe and an application thereof. The probe comprises a first group of probes to a seventeenth group of probes, and the first group of probes to the seventeenth group of probes are probes for detecting Neisseria meningitides, Bacillus pyocyaneus, Salmonella, Stenotrophomonas maltophilia, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumonia, Serratia marcescens, Acinetobacter lwoffii, Corynebacteria diphtheria, Streptococcus mitis, Acinetobacter baumannii, Streptococcus pneumonia, Propionibacterium acnes, Listeria monocytogenes, Enterobacter cloacae and Haemophilus influenza sequentially. The probe is developed through an MLPA technology, can rapidly diagnose post-neurosurgical intracranial bacterial infection 17 common pathogenic bacteria once, provides possibility for rapid diagnosis of pathogenic bacteria of like patients, and is helpful for reducing the fatality and the disability rate of like infection.

The invention provides fluorescent quantitative PCR detection primers and method of acinetobacter lwoffii. The primers have the nucleotide sequences of TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA. The detection method includes the steps of firstly, extracting DNA of a to-be-detected sample; secondly, amplifying acinetobacter lwoffii by means of the fluorescent quantitative PCR method through the primers with the DNA as the template, and collecting fluorescent value Ct sample values at the annealing stage of 55 DEG C; thirdly, establishing a standard curve of bacteria number 1g standard and Ct standard values of acinetobacter lwoffii according to the Ct standard values corresponding to model bacteria concentrations of *102, *103, *104, *105, *106 and *107, and determining the number of acinetobacter lwoffii in the sample on the standard curve according to the Ct sample values. The primers are high in specificity and sensitivity, the detection limitation of the primers can reach *102 cfu/mL, and the detection method is rapid, accurate and short in consumed time.

The invention relates to a method for increasing the yield of bacterium curdlan by using acinetobacter. The method comprises the step of co-culturing acinetobacter lwoffii and curdlan producing bacteria to obtain the bacterium curdlan. By using the method disclosed by the invention, the yield of the curdlan producing bacteria is increased, and a novel method for producing curdlan through microbial fermentation is provided.

The invention relates to compound bacteria and a method for preparing textile fiber using the compound bacteria. The compound bacteria comprise bacillus stored with a number of CGMCC No. 5971, acinetobacter lwoffii stored with a number of CGMCC No. 5973, pseudomonas fluorescens stored with a number of CGMCC No. 5974, and Wickerhamomyces anomalus stored with a number of CGMCC No. 5975. The method comprises the following steps of: preparing bacteria liquid; processing raw materials; and preparing fibers, wherein fiber preparing steps comprise the following steps of: carrying out biodegradation, sterilizing through steam, and obtaining the fibers; drying; and carding. The method provided by the invention is environment-friendly; waste liquid is directly transformed into organic fertilizer, therefore, zero emission and zero pollution are achieved. A biological treating process performs protection to the fibers. Compared with a traditional chemical method, the method provided by the invention has the advantages of being low in producing cost, high in economic benefit, and is capable of saving an energy resource and protecting an environment.

The invention relates to biological flora and a biological bacterium liquid pulping method. The composite flora comprises bacillus sp. with the collection number CGMCC No.5971, rheineheimera tangshanensis with the collection umber CGMCC No.5972, acinetobacter lwoffii with the collection number CGMCC No.5973, pseudomonas fluorescens with collection number CGMCC No.5974, and Wickerhamonmyces anomalus with the collection number CGMCC No.5975. The method mainly comprises the following steps of: preparing bacterium-containing liquid; treating raw materials; and pulping, namely defibering, performing biodegradation, performing steam sterilization, coarsely grinding to obtain pulp, finely grinding to obtain pulp, screening pulp materials, performing latency and washing pulp. A paperboard which is prepared by the biological bacterium liquid pulping method can reach above the AA level. Waste liquid produced in the pulping process can be recycled or converted into methane or organic manure which is used as energy resources. Energy resources are saved, and the method is environment-friendly.

The invention relates to acinetobacter lwoffii and a biological bacteria liquid pulping method of the acinetobacter lwoffii. The acinetobacter lwoffii is stored with a number of CGMCC No. 5973. The biological bacteria liquid pulping method mainly comprises the following steps of: preparing bacteria liquid; processing raw materials; and pulping, wherein pulping steps comprise the following steps of: degrading, biologically degrading, sterilizing through steam, carrying out rough pulping, carrying out fine pulping, screening a sizing agent, removing latency, and washing the sizing agent. A paperboard prepared by the biological bacteria liquid pulping method provided by the invention reaches a level over AA grade; waste liquid produced in a pulping process can be recycled or transformed into methane which can be served as an energy resource or organic fertilizer, and therefore, energy resources are saved, and environment protection is achieved.

The invention relates to acinetobacter lwoffii and a method for preparing textile fibers by using the same. The collection number of the acinetobacter lwoffii is CGMCC No.5973. The method comprises the following steps of: preparing a bacterial solution; processing raw material; and preparing fibers, namely biodegradation, steam sterilization, fiber collection, drying and carding. The method disclosed by the invention is completely environment-friendly, because all waste liquid can be directly converted into organic fertilizers. In a biological treatment process, fibers are protected. Compared with the conventional chemical methods, the method has the advantages that the production cost is low, the economic benefit is high, energy can be saved and pollution is avoided.

The invention provides compound bacteria, a compound bacterial agent containing the same, a preparation method of the compound bacterial agent containing the same, and application of the compound bacteria and the compound bacterial agent containing the same. The compound bacteria comprise acinetobacter lwoffii with the preservation number of CGMCC No.5973, wickerhamomyces anomalus with the preservation number of CGMCC No.5975, phanerochaete chrysosporium and pleurotus ostreatus; through synergistic interaction of various bacteria in the compound bacteria, the compound bacteria have a remarkable effect in the aspect of degrading lignin, particularly the lignin in a hemp rod; the problems of overlong time in bio-pulping, low fibre degree and low yield in the prior art are solved; remarkabletechnical effects of high fibre degree, high yield, short working hours, low cost and no environmental pollution are achieved.

The invention discloses a bacterial synthetic community, which is composed of eight bacteria, namely Acinetobacter lwoffii, Bacillus amyloliquefaciens, Curptobacterium luteum, Curptobacterium sp., Methylobacterium platani, Pantoea sp., Pseudomonas parasulva and Pseudomonas sp., compared with a single bacterial strain, the bacterial synthetic community can better control the occurrence and progress of citrus green mold and sour rot, can more enduringly control diseases, can be used for preparing a biological control agent for controlling postharvest diseases of citrus fruits, has good application potential. A new thought and method are provided for controlling the postharvest diseases of the citrus fruits, and the application range of the bacterial synthetic community is widened.

The invention relates to compound bacteria for biological bacteria liquid pulping and application of the compound bacteria. The invention also provides a biological bacteria liquid pulping method. The compound bacteria comprise bacillus stored with a number of CGMCC No. 5971, acinetobacter lwoffii stored with a number of CGMCC No. 5973, and Wickerhamomyces anomalus stored with a number of CGMCC No. 5975. The method mainly comprises the following steps of: preparing bacteria liquid; processing raw materials; and pulping, wherein pulping steps comprise the following steps of: defibering, biologically degrading, sterilizing through steam, carrying out rough pulping, carrying out fine pulping, screening a sizing agent, removing latency, and washing the sizing agent. A paperboard prepared by the biological bacteria liquid pulping method provided by the invention reaches a level over AA grade; waste liquid produced in a pulping process can be recycled or transformed into methane which can be served as an energy resource or organic fertilizer, and therefore, energy sources are saved, and environment protection is achieved.

The invention relates to mixed bacteria and use thereof in cellulose used for preparing additives. The mixed bacteria comprise acinetobacter lwoffii with a collection number of CGMCC No.5973, pseudomonas fluorescens with a collection number of CGMCC No.5974, and wickerhamomyces anomalus with a collection number of CGMCC No.5975. A process for preparing the cellulose used for preparing additives comprises the following steps of: preparing a bacterial solution; processing raw materials; preparing fibers by defibering, biodegradation, steam sterilization and fiber collection; and sterilizing, and grinding. The method is environment-friendly, because waste liquid is changed into organic fertilizers directly rather than being discharged. In the biological treatment process, the fibers are protected. Compared with the conventional chemical methods, the process has the advantages that the production cost is low, the economic benefit is high, energy can be saved and pollution is avoided.

The present invention relates to a composite flora and a pulping method by using a biological bacterial liquid of the composite flora. The composite flora comprises acinetobacter lwoffii with a preservation number of CGMCC No.5973, pseudomonas fluorescens with a preservation number of CGMCC No.5974, and Wickerhamomyces anomalus with a preservation number of CGMCC No.5975. The method mainly comprises: preparing a bacterial liquid; treating raw materials; and pulping, wherein pulping comprises: fiber kneading or squeezing rolling, biodegradation, steam sterilization, crude pulp grinding, fine pulp grinding, pulp material screening, soaking, and pulp washing. The paper board prepared by using the pulping method can achieve a level of more than an AA grade. In addition, waste liquid generated during a pulping process can be recycled or converted into biogas or an organic fertilizer adopted as an energy source so as to provide advantages of energy source saving and environment protection.

The invention discloses a microbial degradation material for a flushing-free closestool and a preparation method of the microbial degradation material, and belongs to the technical field of microorganisms. The microbial degradation material comprises a biological agent and a carrier, wherein biological agent is composed of bacillus subtilis, candida utilis, aspergillus oryzae, pediococcus acidilactici, lactobacillus acidophilus, bacillus pumilus, bacillus cereus, bacillus licheniformis, acinetobacter lwoffii and alcaligenes faecalis, and the volume fractions of the carrier and the biological agent are 85% and 15% respectively. According to the microbial degradation material for the flushing-free closestool, the microbial agent is reasonable in formula and convenient to use, excrement can be efficiently fermented, the excrement is decomposed and synthesized into protein of microorganisms, secondary pollution cannot be caused in the decomposition process, and emission of odorous gas suchas ammonia and nitrogen and the like in an animal farm is effectively reduced.

The present invention relates to a composite flora for biological preparation of textile fibers, and applications thereof. The composite flora comprises bacillus sp. with a preservation number of CGMCC No.5971, acinetobacter lwoffii with a preservation number of CGMCC No.5973, and Wickerhamomyces anomalus with a preservation number of CGMCC No.5975. The method comprises the following steps: preparing a bacterial liquid; treating raw materials; and preparing fibers, wherein fiber preparation comprises biodegradation, steam sterilization, fiber obtaining, drying, and combing. According to the present invention, the method does not pollute the environment, a waste liquid is directly converted into an organic fertilizer so as to achieve zero emission and zero pollution, the biological treatment process provides a protection effect for fibers, advantages of low production cost and high economic benefits are provided compared with the traditional chemical method, and characteristics of energy source saving and environmental protection are provided.