Artemisia apiacea translocator AaPDR3 and application thereof

A technology of transporter and Artemisia annua, applied in the field of bioengineering, can solve the problems of low artemisinin content and inability to fully meet market demand, and achieve the effect of increasing artemisinin content

Active Publication Date: 2017-01-25
SHANGHAI JIAO TONG UNIV
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the content of artemisinin in the plant Artemisia annua is low, and it cannot fully meet the global market demand.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artemisia apiacea translocator AaPDR3 and application thereof
  • Artemisia apiacea translocator AaPDR3 and application thereof
  • Artemisia apiacea translocator AaPDR3 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Cloning of AaPDR3 Gene of Artemisia annua

[0029] 1. Extraction of Total RNA from Artemisia annua Genome

[0030] Take the leaf tissue of Artemisia annua, grind it in liquid nitrogen, add it to a 1.5mL Eppendorf (EP) centrifuge tube filled with lysate, shake it fully, and extract total RNA according to the instructions of the TIANGEN kit. The quality of total RNA was identified by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0031] 2. Cloning of the AaPDR3 gene of Artemisia annua

[0032] Using the extracted total RNA as a template, cDNA was synthesized under the action of PowerScript reverse transcriptase; gene-specific primers were designed according to the sequence of the AaPDR3 gene, and the AaPDR3 gene was amplified from the total cDNA by PCR and sequenced.

[0033] Through the above steps, the full-length 4278bp of the transcription protein in Artemisia annua has been obtained, the coding sequence, that is, the ...

Embodiment 2

[0039] Construction of plant interference expression vector containing AaPDR3 gene

[0040] 1. Construction of the intermediate vector pTOPO‐AaPDR3

[0041] Upstream primers and downstream primers were designed in the non-conserved region of the AaPDR3 gene to construct interference vectors. Add CACC four bases before the upstream primer to construct Gateway entry vector. According to Invitrogen pENTR TM / The operation steps of the Cloning Kit are to first amplify the fragment of AaPDR3 with flat-end enzyme, recover and purify it, and connect it to the pENTR / D-TOPO vector through Gateway cloning technology.

[0042] 2. Construction of plant expression interference vector pHELLSGATE1.2‐AaPDR3

[0043] According to Invitrogen LR Operation of the II Enzyme kit, the interference fragment of AaPDR3 in the pTOPO‐AaPDR3 vector is recombined into two recombination sites that can form a hairpin structure in the RNA interference vector pHELLSGATE1.2, and the RNA interference vec...

Embodiment 3

[0048] Construction of Plant Overexpression Vector Containing AaPDR3 Gene

[0049] The AaPDR3 gene was constructed on the overexpression vector. In order to facilitate the construction of the expression vector, the restriction site of BamHI was introduced into the forward primer, and the restriction site of XbaI was introduced into the reverse primer. The primers are shown in Table 4;

[0050] Table 4 shows the PCR primers BamHI-AaPDR3-FP (SEQ ID No.7) and AaPDR3-XbaI-RP (SEQ ID No.8) used in the above-mentioned overexpression vector construction

[0051] Primer name Primer sequence (5'→3') BamHI‐AaPDR3‐FP CGGGATCCATGGATGGAAGTGATATTTA AaPDR3-XbaI-RP GCTCTAGACTATCTCTTTTGGAAATTAAATGC

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artemisia apiacea translocator AaPDR3 and an application thereof. The amino acid sequence is shown as SEQ ID No.2; the artemisia apiacea translocator AaPDR3 can affect the synthesizing of sesquiterpenes in artemisia apiacea non-secreting type glandular hair; the translocator is encoded by the nucleotide sequence shown as SEQ ID No.1. The invention further provides a method for realizing transgenosis artemisia apiacea seedlings with the artemisia apiacea translocator AaPDR3.

Description

technical field [0001] The invention relates to a technology in the field of bioengineering, in particular to an Artemisia annua transporter AaPDR3 and its application. Background technique [0002] Artemisia annua L. is an annual herb belonging to the family Asteraceae. Artemisinin, a sesquiterpene lactone oxide containing a peroxy bridge extracted from its aerial part, is currently the most widely used and effective antimalarial drug, especially for cerebral malaria and anti-chloroquine malaria. . Currently, artemisinin combination therapies (ACTs) are the most effective treatment for malaria recommended by the World Health Organization. However, the content of artemisinin in the plant Artemisia annua is low, which cannot fully meet the global market demand. Artemisia annua has glandular trichomes and nonglandular trichomes. There are a large number of secretory glandular hairs on the front and back of leaves, stems and flowers of Artemisia annua. This is where a large...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/84A01H5/00
Inventor唐克轩付雪晴石璞何倩沈乾唐岳立潘琪芳黎凌孙小芬
OwnerSHANGHAI JIAO TONG UNIV