Application of insertion/deletion polymorphic locus in sudden unexplained death detecting kit

A technology of polymorphic sites and kits, applied in the biological field, can solve the problems of not predicting the susceptibility to SUD

Active Publication Date: 2017-02-01
SUZHOU UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, there is no research report on the correlation between the rs10692285 insertion/deletion polymorphism and SUD, and there is

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of insertion/deletion polymorphic locus in sudden unexplained death detecting kit
  • Application of insertion/deletion polymorphic locus in sudden unexplained death detecting kit
  • Application of insertion/deletion polymorphic locus in sudden unexplained death detecting kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The kit includes: fluorescently labeled specific primer pairs for detecting the rs10692285 site of RYR2, and common PCR amplification and capillary electrophoresis components. Wherein, the specific primer pair includes a sense primer sequence and an antisense primer sequence, specifically as follows:

[0042] Sense primer sequence: 5'-GCATGTTTATTATGCAAGTT-3', Tm value is 50°C;

[0043] Antisense primer sequence: 5'-ATACAATTAAGCCCACGA-3', Tm value is 51°C.

[0044] Common components for general PCR amplification and capillary electrophoresis include: 2.5U / μL Taq DNA polymerase, 2.5mM dNTP, 25mM MgCl 2 solution, 10X PCR reaction buffer, and deionized water.

[0045] The use steps of the test kit of the present invention are as follows:

[0046] Step 1: Extraction of DNA template

[0047] Use the blood genomic DNA extraction system to extract genomic DNA from peripheral blood. In this example, the QIAamp DNAMini Kit is used to extract blood sample DNA kit. The operation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an application of a No.rs10692285 insertion/deletion polymorphic locus on the gene of a Ryanodine receptor type 2 in detecting sudden unexplained death, and the invention also discloses a kit for detecting the sudden unexplained death. The kit comprises a specific primer pair for detecting the No.rs10692285 insertion/deletion polymorphic locus on the gene of the Ryanodine receptor type 2, wherein the specific primer pair is as follows: a sense primer: 5'GCATGTTTATTATGCAAGTT3', and an antisense primer: 5'ATACAATTAAGCCCACGA3'; or the sequence of a sense primer: 5'CATTCATTGCATGTTTATTATG3', and the sequence of an antisense primer: 5'CATTATTTCACAGCACCCG3'; or the sequence of a sense primer: 5'TAAATGAACAAAGAAAACCTTC\3', and the sequence of an antisense primer: 5'CTCGGTCACAGTAGGTGG3'. The kit provided by the invention, by detecting and analyzing the gene carrying type of the rs10692285 locus on the gene of the Ryanodine receptor type 2 of an individual, can predict the susceptibility of the individual to the sudden unexplained death.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of an insertion / deletion polymorphic site in a detection kit for sudden death of unknown cause. Background technique [0002] Sudden death is unexpected sudden death caused by underlying diseases of the body or acute dysfunction of vital organs. Sudden death accounts for about 10% or more of all natural deaths. According to the analysis of sudden death due to diseases in my country, sudden death due to cardiovascular disease accounts for about 50% to 60%, ranking first in the incidence of sudden death, which shows the great harm of sudden cardiac death. In addition, there are still some cases of sudden death that failed to find fatal pathological changes and other causes of death after systematic autopsy and related laboratory tests. This kind of sudden death is usually classified as sudden unexplained death (SUD). The screening diagnosis of patients at risk of sudde...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/156
Inventor 高玉振何艳李立娟王守宇
Owner SUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap