Special primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis

A peony and variety technology, applied in the field of molecular biology, can solve problems such as weak basic research, and achieve the effects of saving the cost of measurement and making the detection convenient and quick.

Active Publication Date: 2017-04-26
QINGDAO AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As an emerging oil crop, the development and utilization of peony re

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Special primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis
  • Special primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis
  • Special primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Preparation of standard solution

[0025] Preparation of internal standard solution: Dissolve 30 mg of methyl nonadecanoate (Methyl nonadecanoate) standard product in 10 mL of methanol to prepare a standard solution with a mass concentration of 3 mg / mL for use.

[0026] Determination of fatty acid composition

[0027] (1) Each weighed 300 mg of seeds of peony cultivar 'Fengdan' at different days (50-130 days) after pollination, fully ground them into powder with liquid nitrogen, dissolved them in chloroform, and stored them at -20°C.

[0028] (2) Take 1 mL of the total lipid dissolved in chloroform into a 10 mL penicillin vial.

[0029] (3) Add 100 μL of internal standard solution, and then add 2.5 mL of 2% H 2 SO 4 : methanol solution (v:v).

[0030] (4) 85°C water bath for 2.5 hours.

[0031] (5) After the reaction is completed, cool to room temperature, add 1 mL of n-hexane (chromatographic grade) and 1 mL of saturated NaCl solution, shake, and place to separate...

Embodiment 2

[0042] Homologous amplification of embodiment 2 PsOLE1 gene

[0043] Seeds from 7-8-year-old peony cultivar 'Fengdan' healthy plants (planted in the experimental field of Qingdao Agricultural University in Shandong Province) were quick-frozen in liquid nitrogen and stored in a -80°C refrigerator for use in homologous amplification of the PsOLE1 gene and RACE PCR reaction.

[0044] (1) Homologous amplification:

[0045] The reaction system was 50 μL, and the components were as follows: 2 μL reverse-transcribed cDNA, 5 μL 10×LA TaqBuffer II (Mg 2+ Plus), 4 μL dNTP Mixture (2.5 mM each), Primer F / R (F: GTCACWGCYGGTGGRTCTCT, R: CCAAACTGCTCCAGCYCTGTC) (10 μM) each 2 μL, 0.4 μL LA Taq (5 U / μL) and 34.6 μL ddH 2 O.

[0046] Gradient PCR amplification conditions for homologous clones: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30s, annealing at 50-60°C for 30s, extension at 72°C for 30s, a total of 35 cycles, and finally extension at 72°C for 10 minutes, and s...

Embodiment 3

[0047] Example 3: RACE PCR of the PsOLE1 gene:

[0048] according to According to the requirements of RACE primers (23-28nt, 50-70% GC, Tm≥65°C) in the RACE 5' / 3' Kit manual, design gene-specific primers (gene -specific primers, GSPs, GSP5': CACCGAATCCACCTGAAGCAAGAAAC, GSP3': TGCTTCAGGTGGATTCGGTGTGGC). 50μL system, 5'-RACE composition is as follows: 2.5μL 5'-RACE-Ready-cDNA, 5μL 10×UPM, 1μL GSP5'(10μM), 41.5μL Master Mix; 3'-RACE composition is as follows: 2.5μL 3'-RACE - Ready-cDNA, 5 μL 10×UPM, 1 μL GSP3′ (10 μM), 41.5 μL Master Mix. The RACE amplification reaction conditions are as follows: 94°C, 30s, 68°C, 30s, 72°C, 3min, a total of 25 cycles. The total RNA from seeds at different stages was mixed as a template for the synthesis of the first-strand cDNA (5'-RACE-Ready-cDNA and 3'-RACE-Ready-cDNA). Using 5'-RACE-Ready-cDNA and 3'-RACE-Ready-cDNA as templates, gene-specific primers (GSP5' and GSP3') were paired with UPM, and amplified by RACE PCR to obtain 5'-RACE PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a pair of specific primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis, and belongs to the field of molecular biology. The invention further provides the cDNA sequence SEQ No.1 of an oleosin gene PsOLE1 of a peony variety Fengdan, and a cloning method thereof, degenerate primers and RACE amplification primers for the cloning, real-time quantitative primers for the oleosin gene PsOLE1 of the peony variety Fengdan, and a method for auxiliary and rapid detection of the peony variety Fengdan seed fatty acid synthesis through real-time quantitative PCR with the real-time quantitative primers. According to the present invention, by using the oleosin gene, the peony variety Fengdan seed harvesting time can be guided; and compared to the traditional GC-MS technology for determining the fatty acid content, the method of the present invention has advantages of convenient and rapid detection and substantially saved determination cost so as to provide the scientific auxiliary tool for the harvesting time of the peony seed.

Description

technical field [0001] The invention belongs to the field of molecular biology, and specifically relates to the cloning of an oil body protein gene PsOLE1 of a peony variety 'Fengdan' and a pair of special primers that can assist in the identification of fatty acid synthesis in the seeds of the peony variety 'Fengdan'. Background technique [0002] Peony has high ornamental value and medicinal value. The seed oil extracted from peony seed kernels passed the toxicological safety evaluation, and was approved by the Ministry of Health as a new resource food on March 22, 2011, making peony seed oil one of the edible oils, and the peony seed oil industry is booming The upsurge of national oil peony industry development is coming. As a new oil crop, the development and utilization of peony resources are in their infancy, and the related basic research is very weak. Wang Liangsheng's research group collected materials from the oil peony variety 'Fengdan' every 10 days after polli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/10C12N15/11C12Q1/68
CPCC07K14/415C12N15/1027C12Q1/6895C12Q2600/13C12Q2600/158C12Q2531/113
Inventor 张玉喜盖树鹏
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap