Unlock instant, AI-driven research and patent intelligence for your innovation.

Positive reference with AA type of 681 site of human CYP2C19*2 gene as template

A technology of CYP2C19 and reference products, applied in the field of molecular biology, to achieve the effect of solving quality detection problems

Inactive Publication Date: 2017-08-25
TOYO TOYOBO CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a positive reference product with AA type at 681 site of human CYP2C19*2 gene as a template, which is used to verify whether the detection result of AA type at 681 site of human CYP2C19*2 gene in the tested sample is accurate, and to solve Solved the quality detection problem of human CYP2C19*2 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Positive reference with AA type of 681 site of human CYP2C19*2 gene as template
  • Positive reference with AA type of 681 site of human CYP2C19*2 gene as template
  • Positive reference with AA type of 681 site of human CYP2C19*2 gene as template

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] Example: A positive reference product using the AA type at site 681 of the human CYP2C19*2 gene as a template

[0021] GG-type positive reference substance is a reagent with base sequence as the main component, the base sequence contains human CYP2C19*2 gene fragment, said human CYP2C19*2 gene fragment is 5'-TTACAACCAGAGCTTGGCATATTGTATCTATACCTTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCC G GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTA-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 681 site of the human CYP2C19*2 gene, and the 681 site is used to characterize the GG of the human CYP2C19*2 gene Type AA can be mutated to the position of type AA of the human CYP2C19*2 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.

[0022] Type AA positive reference substance is a reagent with a base sequence as the main co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Theinvention relates to a positive reference with an AA type of a 681 site of a human CYP2C19*2 gene as a template. The positive reference is characterized in that the positive reference is a reagent with a base sequence as a main component. The base sequence comprises a human CYP2C19*2 gene fragment, and the human CYP2C19*2 gene fragment is shown as in SEQ NO:5, wherein an underlined base site is the 681 site of the human CYP2C19*2 gene, and the 681 site is used for representing a position at which the AA type of the human CYP2C19*2 gene can be mutated from a GG type of the human CYP2C19*2 gene. The positive reference is used for verifying whether a detection result that the 682 site of the human CYP2C19*2 gene in detected samples is accurate, and solves a problem of quality detection of the human CYP2C19*2 gene.

Description

technical field [0001] The present invention relates to the technical field of molecular biology, in particular to a positive reference product using the AA type at site 681 of the human CYP2C19*2 gene as a template. Auxiliary judgment of whether the sample is positive or not during the test. Background technique [0002] Quality control substances refer to quality control substances used in in vitro diagnostics, which have target detection substances with known concentrations, and are necessary products to make people believe that the quality of a certain product or service can meet the specified quality requirements. The purpose of quality control is to verify the accuracy, effectiveness and specificity of the entire PCR reaction process, and to monitor the status of the detection system. After the instrument is officially put into use, it should be calibrated regularly to avoid experimental deviations caused by the instrument. Thirdly, after receiving each batch of new ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q2600/166
Inventor 孙茜
Owner TOYO TOYOBO CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More