Positive reference with AA type of 681 site of human CYP2C19*2 gene as template
A technology of CYP2C19 and reference products, applied in the field of molecular biology, to achieve the effect of solving quality detection problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Example: A positive reference product using the AA type at site 681 of the human CYP2C19*2 gene as a template
[0021] GG-type positive reference substance is a reagent with base sequence as the main component, the base sequence contains human CYP2C19*2 gene fragment, said human CYP2C19*2 gene fragment is 5'-TTACAACCAGAGCTTGGCATATTGTATCTATACCTTTTATTAAATGCTTTTAATTTAATAAATTATTGTTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCC G GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTA-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 681 site of the human CYP2C19*2 gene, and the 681 site is used to characterize the GG of the human CYP2C19*2 gene Type AA can be mutated to the position of type AA of the human CYP2C19*2 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.
[0022] Type AA positive reference substance is a reagent with a base sequence as the main co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


