Positive reference with GG type of 636 site of human CYP2C19*3 gene as template
A CYP2C19, reference technology, applied in the field of molecular biology to achieve the effect of solving the problem of quality inspection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Example: A positive reference product based on the GG type at site 636 of the human CYP2C19*3 gene as a template
[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a human CYP2C19*3 gene fragment, and the human CYP2C19*3 gene fragment is 5'-AACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTG G ATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATTGACCAAGCCCTGAAGTACATTTTTGAATAC-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 636 site of the human CYP2C19*3 gene, and the 636 site is used to characterize the GG of the human CYP2C19*3 gene Type AA can be mutated to the position of the human CYP2C19*3 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.
[0022] Type AA positive reference substance is a reagent with a base sequence as the main component. The base seq...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com