A 5-carbonyl-2-pentenoyl-CoA reductase mutant
A pentenoyl coenzyme and mutant technology, applied in the field of bioengineering, can solve problems such as inability to efficiently accumulate adipic acid, and achieve the effects of promoting popularization and application, increasing production, and reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Mutation site selection
[0031] homology modeling
[0032] Based on the amino acid sequence SEQID NO.1 of 5-carbonyl-2-pentenoyl-CoA reductase (the corresponding gene is Tfu-1647), use swiss-model to reduce 5-carbonyl-2-pentenoyl-CoA The homology modeling of the enzyme was carried out, and the model model-1647 was obtained.
[0033] Prediction of active pocket and active site
[0034] Use Discovery Studio 3.0 to simulate the model model-1647, looking for active pockets, such as figure 2 shown.
Embodiment 2
[0035] Embodiment 2: the construction of mutant
[0036] A mutant E334R was successfully constructed by site-directed mutagenesis.
[0037] Specific steps are as follows:
[0038] (1) Site-directed mutation
[0039] Taking the mutation point as the center, and extending 15-20 bp before and after the mutation point, the designed sequence of the primer pair shown in SEQ ID NO.3 / SEQ ID NO.4 is No. 6-F: agtgatgtcgctatgaggattactactgatgccgtgca / No. 6-R: ggcatcagtagtaatcctcatagcgacatcactggcg.
[0040] Take the mutation point as the center, and use the plasmid pTrc99A-0067-1647 connected with the parental gene as the template (see the plasmid map image 3 ) for whole plasmid PCR (see Table 1 for the PCR system). Wherein the plasmid pTrc99A-0067-1647 connected with the parental gene refers to the gene and amino acid sequence of 3-hydroxyadipyl dehydrogenase such as SEQ ID NO.1 connected to the amino acid sequence shown in SEQ ID NO.7 on the plasmid pTrc99A 5-Carbonyl-2-pentenoyl-Co...
Embodiment 3
[0057] Example 3: Effect of mutants on adipate accumulation
[0058] Fermentation of mutant recombinant bacteria
[0059] Pick the single colony of the mutant strain No. 6 expressing the mutant E334R obtained in Example 2 and insert it into the LB medium containing Kan, Amp, and Str (concentrations are all 50 μg / mL) three kinds of antibiotics, 37 ° C, 220 r / mL Cultivate overnight on a shaking table (seed liquid), and insert the seed liquid into the fermentation medium M9 at a ratio of 2% (in addition to the salt that must be contained in M9, it also contains 1.5-2.5mM MgSO4, 0.08-0.12mM CaCl2, 50g / mL of Kan, Amp, Str three antibiotics and 4g / L of glucose), after the bacteria grow to about OD=0.7, add 1M IPTG30uL for induction, and then transfer to 30°C shaker culture. 1.5mL samples were taken at 10h, 14h, 18h, 22h, 26h, 30h, 34h, 38h, 42h, and 46h after induction, placed in 2mL centrifuge tubes, stored at -20°C or directly used in subsequent experiments.
[0060] High perfor...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More