A method for knocking out the chromosome of Saccharomyces cerevisiae

A technology of Saccharomyces cerevisiae and Saccharomyces cerevisiae strains, applied to methods based on microorganisms, other methods of inserting foreign genetic materials, and stably introducing foreign DNA into the middle direction of chromosomes, which can solve the problem of large workload of complete chromosomes and failure to ensure the integrity of a single chromosome , low efficiency and other issues, to achieve the effect of avoiding cross exchange, high success rate, and rapid knockout

Active Publication Date: 2020-06-16
TIANJIN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing method of using the unequal distribution of yeast chromosomes during meiosis to achieve chromosome loss, in the process of meiosis, homologous recombination will occur between homologous chromosomes of yeast, and the integrity of a single chromosome cannot be guaranteed
This method requires a lot of work and low efficiency to obtain a complete chromosome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for knocking out the chromosome of Saccharomyces cerevisiae
  • A method for knocking out the chromosome of Saccharomyces cerevisiae
  • A method for knocking out the chromosome of Saccharomyces cerevisiae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Knockout of synIII artificial Saccharomyces cerevisiae synthetic type III chromosome

[0030]1. The synIII artificial Saccharomyces cerevisiae yYW0233 (MATα, BY4742 based on the artificial synthesis of chromosome III) strain to be knocked out to synthesize chromosome III (synIII) ​​and the yYW0171 (MATa, namely BY4741) strain containing wild chromosome III (wtIII) were brewed Yeast) strains were compared, and the guide RNA recognizable site gRNA-synIII ce n-L "ttatacgaagttattataagCGG" was found near the synI II centromere within 100bp, where CGG is the PAM sequence, and ttatacgaagttattataag is the protospacers sequence.

[0031] 2. Construct guide-RNA plasmid, the construction steps are as follows:

[0032] Select the protospacers as ttatacgaagttattataag, and use the NotI restriction site of the pRS42H plasmid as the insertion point;

[0033] Artificially synthesized primers "GCAGTGAAAGATAAATGATCttatacgaagttattataagGTTTTAGAGCTAGAAATAGC" and "GCTATTTCTAGCTCTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and specifically discloses a method for knocking down brewing yeast chromosome. The method is characterized in that the complete yeast chromosome is cut according to the CRISPR / Cas9 base technology; a specificity target close to centromere is selected; a corresponding guide RNA is designed to guide Cas9 protein to generate an incision closeto the centromere, thus realizing the knocking down of the whole chromosome. Compared with the conventional method for losing the whole chromosome in manners such as inducing through a Ga1 promoter, and reductional division, the method has the advantages that the brewing yeast chromosome is simply, efficiently and quickly cut; the cross exchange of sister chromatids can be avoided; the chromosome-knocked-down homozygous brewing yeast diploid strain can be obtained.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to a method for knocking out the chromosome of Saccharomyces cerevisiae. Background technique [0002] The biological genome carries the genetic information that determines the basic traits of the organism. Artificial DNA synthesis technology and DNA large fragment manipulation technology have promoted the progress of genome artificial synthesis research. The development of synthetic biology has promoted the "writing" of genome information through artificial design and synthesis, marking the beginning of "artificial life". [0003] The length of genomic DNA is too large, and most eukaryotes have multiple chromosomes, and the length of the chromosomes is relatively large. When it comes to chromosomal diseases or functional integration of chromosomes, the entire chromosome needs to be manipulated. How to achieve the knockout of the entire chromosome is a question worth ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/04C12N15/81C12N15/90C12N9/22C12R1/865
CPCC12N9/22C12N15/04C12N15/81C12N15/905
Inventor元英进吴毅周嗣杰徐晖李云祥
OwnerTIANJIN UNIV